ID: 1067186210

View in Genome Browser
Species Human (GRCh38)
Location 10:44030122-44030144
Sequence CTGTCTAAAGGACTGCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067186210_1067186214 7 Left 1067186210 10:44030122-44030144 CCTTCAAGCAGTCCTTTAGACAG No data
Right 1067186214 10:44030152-44030174 CTACTGCTGCTCTGTCTTTTTGG No data
1067186210_1067186215 28 Left 1067186210 10:44030122-44030144 CCTTCAAGCAGTCCTTTAGACAG No data
Right 1067186215 10:44030173-44030195 GGTGACCCCATCCATTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067186210 Original CRISPR CTGTCTAAAGGACTGCTTGA AGG (reversed) Intergenic
No off target data available for this crispr