ID: 1067186210 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:44030122-44030144 |
| Sequence | CTGTCTAAAGGACTGCTTGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1067186210_1067186214 | 7 | Left | 1067186210 | 10:44030122-44030144 | CCTTCAAGCAGTCCTTTAGACAG | No data | ||
| Right | 1067186214 | 10:44030152-44030174 | CTACTGCTGCTCTGTCTTTTTGG | No data | ||||
| 1067186210_1067186215 | 28 | Left | 1067186210 | 10:44030122-44030144 | CCTTCAAGCAGTCCTTTAGACAG | No data | ||
| Right | 1067186215 | 10:44030173-44030195 | GGTGACCCCATCCATTCCTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1067186210 | Original CRISPR | CTGTCTAAAGGACTGCTTGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||