ID: 1067186214

View in Genome Browser
Species Human (GRCh38)
Location 10:44030152-44030174
Sequence CTACTGCTGCTCTGTCTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067186208_1067186214 15 Left 1067186208 10:44030114-44030136 CCTCTCTCCCTTCAAGCAGTCCT No data
Right 1067186214 10:44030152-44030174 CTACTGCTGCTCTGTCTTTTTGG No data
1067186211_1067186214 -5 Left 1067186211 10:44030134-44030156 CCTTTAGACAGAACCCAACTACT No data
Right 1067186214 10:44030152-44030174 CTACTGCTGCTCTGTCTTTTTGG No data
1067186210_1067186214 7 Left 1067186210 10:44030122-44030144 CCTTCAAGCAGTCCTTTAGACAG No data
Right 1067186214 10:44030152-44030174 CTACTGCTGCTCTGTCTTTTTGG No data
1067186209_1067186214 8 Left 1067186209 10:44030121-44030143 CCCTTCAAGCAGTCCTTTAGACA No data
Right 1067186214 10:44030152-44030174 CTACTGCTGCTCTGTCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067186214 Original CRISPR CTACTGCTGCTCTGTCTTTT TGG Intergenic
No off target data available for this crispr