ID: 1067186215

View in Genome Browser
Species Human (GRCh38)
Location 10:44030173-44030195
Sequence GGTGACCCCATCCATTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067186213_1067186215 2 Left 1067186213 10:44030148-44030170 CCAACTACTGCTGCTCTGTCTTT No data
Right 1067186215 10:44030173-44030195 GGTGACCCCATCCATTCCTCAGG No data
1067186210_1067186215 28 Left 1067186210 10:44030122-44030144 CCTTCAAGCAGTCCTTTAGACAG No data
Right 1067186215 10:44030173-44030195 GGTGACCCCATCCATTCCTCAGG No data
1067186209_1067186215 29 Left 1067186209 10:44030121-44030143 CCCTTCAAGCAGTCCTTTAGACA No data
Right 1067186215 10:44030173-44030195 GGTGACCCCATCCATTCCTCAGG No data
1067186211_1067186215 16 Left 1067186211 10:44030134-44030156 CCTTTAGACAGAACCCAACTACT No data
Right 1067186215 10:44030173-44030195 GGTGACCCCATCCATTCCTCAGG No data
1067186212_1067186215 3 Left 1067186212 10:44030147-44030169 CCCAACTACTGCTGCTCTGTCTT No data
Right 1067186215 10:44030173-44030195 GGTGACCCCATCCATTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067186215 Original CRISPR GGTGACCCCATCCATTCCTC AGG Intergenic
No off target data available for this crispr