ID: 1067187176

View in Genome Browser
Species Human (GRCh38)
Location 10:44040506-44040528
Sequence TGTGGGGCATAAAACTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067187174_1067187176 -9 Left 1067187174 10:44040492-44040514 CCATGGCTAAAGTGTGTGGGGCA No data
Right 1067187176 10:44040506-44040528 TGTGGGGCATAAAACTGGAGAGG No data
1067187170_1067187176 -3 Left 1067187170 10:44040486-44040508 CCAGGACCATGGCTAAAGTGTGT No data
Right 1067187176 10:44040506-44040528 TGTGGGGCATAAAACTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067187176 Original CRISPR TGTGGGGCATAAAACTGGAG AGG Intergenic
No off target data available for this crispr