ID: 1067188641

View in Genome Browser
Species Human (GRCh38)
Location 10:44051577-44051599
Sequence TTCAAGGCCGTTACTGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067188641_1067188643 -3 Left 1067188641 10:44051577-44051599 CCATTTGCAGTAACGGCCTTGAA No data
Right 1067188643 10:44051597-44051619 GAACCTGTCTGAGATCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067188641 Original CRISPR TTCAAGGCCGTTACTGCAAA TGG (reversed) Intergenic
No off target data available for this crispr