ID: 1067196398

View in Genome Browser
Species Human (GRCh38)
Location 10:44123254-44123276
Sequence GTGGGCCTGCCTCCCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067196398_1067196404 1 Left 1067196398 10:44123254-44123276 CCTGGAGAGGGAGGCAGGCCCAC No data
Right 1067196404 10:44123278-44123300 CCTTGAGGACTTCAAATGCAGGG No data
1067196398_1067196405 2 Left 1067196398 10:44123254-44123276 CCTGGAGAGGGAGGCAGGCCCAC No data
Right 1067196405 10:44123279-44123301 CTTGAGGACTTCAAATGCAGGGG No data
1067196398_1067196402 0 Left 1067196398 10:44123254-44123276 CCTGGAGAGGGAGGCAGGCCCAC No data
Right 1067196402 10:44123277-44123299 ACCTTGAGGACTTCAAATGCAGG No data
1067196398_1067196406 5 Left 1067196398 10:44123254-44123276 CCTGGAGAGGGAGGCAGGCCCAC No data
Right 1067196406 10:44123282-44123304 GAGGACTTCAAATGCAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067196398 Original CRISPR GTGGGCCTGCCTCCCTCTCC AGG (reversed) Intergenic
No off target data available for this crispr