ID: 1067197439

View in Genome Browser
Species Human (GRCh38)
Location 10:44134322-44134344
Sequence ATATTATGGTGGGCTGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067197433_1067197439 0 Left 1067197433 10:44134299-44134321 CCCTGTGGGACAGCCTTCTTAAC No data
Right 1067197439 10:44134322-44134344 ATATTATGGTGGGCTGCAACTGG No data
1067197430_1067197439 24 Left 1067197430 10:44134275-44134297 CCAGGTTGAGCTCAGAGTGGGCT No data
Right 1067197439 10:44134322-44134344 ATATTATGGTGGGCTGCAACTGG No data
1067197434_1067197439 -1 Left 1067197434 10:44134300-44134322 CCTGTGGGACAGCCTTCTTAACA No data
Right 1067197439 10:44134322-44134344 ATATTATGGTGGGCTGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067197439 Original CRISPR ATATTATGGTGGGCTGCAAC TGG Intergenic
No off target data available for this crispr