ID: 1067200774

View in Genome Browser
Species Human (GRCh38)
Location 10:44170167-44170189
Sequence AGATGATTCTGCCCCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067200774_1067200777 -5 Left 1067200774 10:44170167-44170189 CCAGCAGAGGGGCAGAATCATCT No data
Right 1067200777 10:44170185-44170207 CATCTGGACAGAGAGGCTCATGG No data
1067200774_1067200783 8 Left 1067200774 10:44170167-44170189 CCAGCAGAGGGGCAGAATCATCT No data
Right 1067200783 10:44170198-44170220 AGGCTCATGGCTTGGGGCTGGGG No data
1067200774_1067200781 6 Left 1067200774 10:44170167-44170189 CCAGCAGAGGGGCAGAATCATCT No data
Right 1067200781 10:44170196-44170218 AGAGGCTCATGGCTTGGGGCTGG No data
1067200774_1067200785 27 Left 1067200774 10:44170167-44170189 CCAGCAGAGGGGCAGAATCATCT No data
Right 1067200785 10:44170217-44170239 GGGGACCAAATGCCCTTGCTGGG No data
1067200774_1067200778 0 Left 1067200774 10:44170167-44170189 CCAGCAGAGGGGCAGAATCATCT No data
Right 1067200778 10:44170190-44170212 GGACAGAGAGGCTCATGGCTTGG No data
1067200774_1067200782 7 Left 1067200774 10:44170167-44170189 CCAGCAGAGGGGCAGAATCATCT No data
Right 1067200782 10:44170197-44170219 GAGGCTCATGGCTTGGGGCTGGG No data
1067200774_1067200784 26 Left 1067200774 10:44170167-44170189 CCAGCAGAGGGGCAGAATCATCT No data
Right 1067200784 10:44170216-44170238 TGGGGACCAAATGCCCTTGCTGG No data
1067200774_1067200779 1 Left 1067200774 10:44170167-44170189 CCAGCAGAGGGGCAGAATCATCT No data
Right 1067200779 10:44170191-44170213 GACAGAGAGGCTCATGGCTTGGG No data
1067200774_1067200780 2 Left 1067200774 10:44170167-44170189 CCAGCAGAGGGGCAGAATCATCT No data
Right 1067200780 10:44170192-44170214 ACAGAGAGGCTCATGGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067200774 Original CRISPR AGATGATTCTGCCCCTCTGC TGG (reversed) Intergenic