ID: 1067200784

View in Genome Browser
Species Human (GRCh38)
Location 10:44170216-44170238
Sequence TGGGGACCAAATGCCCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067200774_1067200784 26 Left 1067200774 10:44170167-44170189 CCAGCAGAGGGGCAGAATCATCT No data
Right 1067200784 10:44170216-44170238 TGGGGACCAAATGCCCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067200784 Original CRISPR TGGGGACCAAATGCCCTTGC TGG Intergenic