ID: 1067203166

View in Genome Browser
Species Human (GRCh38)
Location 10:44192472-44192494
Sequence TCCTTCCCACAGGTGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067203166_1067203172 -4 Left 1067203166 10:44192472-44192494 CCATGTGCCACCTGTGGGAAGGA No data
Right 1067203172 10:44192491-44192513 AGGAGCTTGGGTCCAGAGAAGGG No data
1067203166_1067203173 -1 Left 1067203166 10:44192472-44192494 CCATGTGCCACCTGTGGGAAGGA No data
Right 1067203173 10:44192494-44192516 AGCTTGGGTCCAGAGAAGGGAGG No data
1067203166_1067203176 16 Left 1067203166 10:44192472-44192494 CCATGTGCCACCTGTGGGAAGGA No data
Right 1067203176 10:44192511-44192533 GGGAGGGTCTTCTTTTCCAGTGG No data
1067203166_1067203174 0 Left 1067203166 10:44192472-44192494 CCATGTGCCACCTGTGGGAAGGA No data
Right 1067203174 10:44192495-44192517 GCTTGGGTCCAGAGAAGGGAGGG No data
1067203166_1067203171 -5 Left 1067203166 10:44192472-44192494 CCATGTGCCACCTGTGGGAAGGA No data
Right 1067203171 10:44192490-44192512 AAGGAGCTTGGGTCCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067203166 Original CRISPR TCCTTCCCACAGGTGGCACA TGG (reversed) Intergenic
No off target data available for this crispr