ID: 1067203934

View in Genome Browser
Species Human (GRCh38)
Location 10:44197882-44197904
Sequence CTTTCTAGGCAGGAAGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067203924_1067203934 30 Left 1067203924 10:44197829-44197851 CCTGGGCAAAGCAAAAGACAAGG No data
Right 1067203934 10:44197882-44197904 CTTTCTAGGCAGGAAGTGGTAGG No data
1067203928_1067203934 6 Left 1067203928 10:44197853-44197875 CCACATTCACGCAGGTTCCAAGT No data
Right 1067203934 10:44197882-44197904 CTTTCTAGGCAGGAAGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067203934 Original CRISPR CTTTCTAGGCAGGAAGTGGT AGG Intergenic
No off target data available for this crispr