ID: 1067203934 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:44197882-44197904 |
| Sequence | CTTTCTAGGCAGGAAGTGGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1067203924_1067203934 | 30 | Left | 1067203924 | 10:44197829-44197851 | CCTGGGCAAAGCAAAAGACAAGG | No data | ||
| Right | 1067203934 | 10:44197882-44197904 | CTTTCTAGGCAGGAAGTGGTAGG | No data | ||||
| 1067203928_1067203934 | 6 | Left | 1067203928 | 10:44197853-44197875 | CCACATTCACGCAGGTTCCAAGT | No data | ||
| Right | 1067203934 | 10:44197882-44197904 | CTTTCTAGGCAGGAAGTGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1067203934 | Original CRISPR | CTTTCTAGGCAGGAAGTGGT AGG | Intergenic | ||
| No off target data available for this crispr | |||||