ID: 1067205767

View in Genome Browser
Species Human (GRCh38)
Location 10:44211500-44211522
Sequence CAGGAGAAGCAGCATGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067205767_1067205774 28 Left 1067205767 10:44211500-44211522 CCCCCCTCATGCTGCTTCTCCTG No data
Right 1067205774 10:44211551-44211573 AACTGCAAATTTTTTTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067205767 Original CRISPR CAGGAGAAGCAGCATGAGGG GGG (reversed) Intergenic
No off target data available for this crispr