ID: 1067205774

View in Genome Browser
Species Human (GRCh38)
Location 10:44211551-44211573
Sequence AACTGCAAATTTTTTTAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067205770_1067205774 25 Left 1067205770 10:44211503-44211525 CCCTCATGCTGCTTCTCCTGCTC No data
Right 1067205774 10:44211551-44211573 AACTGCAAATTTTTTTAGACTGG No data
1067205771_1067205774 24 Left 1067205771 10:44211504-44211526 CCTCATGCTGCTTCTCCTGCTCT No data
Right 1067205774 10:44211551-44211573 AACTGCAAATTTTTTTAGACTGG No data
1067205767_1067205774 28 Left 1067205767 10:44211500-44211522 CCCCCCTCATGCTGCTTCTCCTG No data
Right 1067205774 10:44211551-44211573 AACTGCAAATTTTTTTAGACTGG No data
1067205769_1067205774 26 Left 1067205769 10:44211502-44211524 CCCCTCATGCTGCTTCTCCTGCT No data
Right 1067205774 10:44211551-44211573 AACTGCAAATTTTTTTAGACTGG No data
1067205772_1067205774 9 Left 1067205772 10:44211519-44211541 CCTGCTCTTGTCTTTTTTGAATC No data
Right 1067205774 10:44211551-44211573 AACTGCAAATTTTTTTAGACTGG No data
1067205768_1067205774 27 Left 1067205768 10:44211501-44211523 CCCCCTCATGCTGCTTCTCCTGC No data
Right 1067205774 10:44211551-44211573 AACTGCAAATTTTTTTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067205774 Original CRISPR AACTGCAAATTTTTTTAGAC TGG Intergenic
No off target data available for this crispr