ID: 1067208372

View in Genome Browser
Species Human (GRCh38)
Location 10:44238708-44238730
Sequence CTGGCTTATGCCTGAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067208372_1067208377 -2 Left 1067208372 10:44238708-44238730 CCAGGGCCTCAGGCATAAGCCAG No data
Right 1067208377 10:44238729-44238751 AGGACACTGCCAGGCAAGCCAGG No data
1067208372_1067208380 20 Left 1067208372 10:44238708-44238730 CCAGGGCCTCAGGCATAAGCCAG No data
Right 1067208380 10:44238751-44238773 GTGAATGTCATCCTAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067208372 Original CRISPR CTGGCTTATGCCTGAGGCCC TGG (reversed) Intergenic
No off target data available for this crispr