ID: 1067211913

View in Genome Browser
Species Human (GRCh38)
Location 10:44266521-44266543
Sequence ACGTTAAGTGCAGGTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067211913_1067211921 -5 Left 1067211913 10:44266521-44266543 CCTGTTCCACCTGCACTTAACGT No data
Right 1067211921 10:44266539-44266561 AACGTGGCCTGGGAAGGGCATGG No data
1067211913_1067211922 -4 Left 1067211913 10:44266521-44266543 CCTGTTCCACCTGCACTTAACGT No data
Right 1067211922 10:44266540-44266562 ACGTGGCCTGGGAAGGGCATGGG No data
1067211913_1067211920 -10 Left 1067211913 10:44266521-44266543 CCTGTTCCACCTGCACTTAACGT No data
Right 1067211920 10:44266534-44266556 CACTTAACGTGGCCTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067211913 Original CRISPR ACGTTAAGTGCAGGTGGAAC AGG (reversed) Intergenic
No off target data available for this crispr