ID: 1067214838

View in Genome Browser
Species Human (GRCh38)
Location 10:44293223-44293245
Sequence GGCCCACGGAAGCTCCGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067214833_1067214838 8 Left 1067214833 10:44293192-44293214 CCAGTGTACTTCTCCTGGGGGCT 0: 1
1: 0
2: 0
3: 19
4: 149
Right 1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 110
1067214835_1067214838 -5 Left 1067214835 10:44293205-44293227 CCTGGGGGCTCCTTTCTAGGCCC 0: 1
1: 0
2: 1
3: 23
4: 177
Right 1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 110
1067214832_1067214838 9 Left 1067214832 10:44293191-44293213 CCCAGTGTACTTCTCCTGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067214838 Original CRISPR GGCCCACGGAAGCTCCGTGT TGG Intronic
900949664 1:5851271-5851293 AGCCCACAGAAGTTCCCTGTAGG - Intergenic
903740608 1:25556411-25556433 GGCCCACTGGGGCTCCTTGTTGG + Intronic
913988327 1:143585662-143585684 GGCCCACGGAAGGTACCTGAGGG + Intergenic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
917373817 1:174325934-174325956 GACCCACGGAAGGTCCCTGAAGG - Intronic
923493918 1:234508385-234508407 GACCCACAGAACCTCCGAGTTGG - Intergenic
1063389505 10:5640196-5640218 GGCCCACGGAAGGTCGGCCTGGG - Exonic
1067066428 10:43106531-43106553 GGCCAACGGCAGCTTCGTGCGGG + Exonic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1067278467 10:44854020-44854042 GGCCAGCGGAAGCCCCGTGAAGG + Intergenic
1067567536 10:47349656-47349678 GGCCCACAGAAACTCCTTCTTGG + Exonic
1070999126 10:80814234-80814256 GGCCAACGGGAGTTCCGGGTGGG + Intergenic
1074791139 10:116888769-116888791 AACCCTCGGAAGGTCCGTGTAGG - Intronic
1076797906 10:132807728-132807750 GGCCTACAGAAGCTCAGTGCGGG - Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1079241886 11:18727435-18727457 GGCCCAGGGAATCTGCATGTGGG - Intergenic
1106370340 13:29126711-29126733 GGCCCAGGGAAGCTACATATTGG + Intronic
1110876105 13:80512241-80512263 GGCCCAAGGAAGCTCTGCCTGGG - Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114344500 14:21781003-21781025 GGCCAAGGGAAGCTTGGTGTGGG + Intergenic
1114365947 14:22027171-22027193 CTCCCACGGAAGCTCAGTGTGGG + Intergenic
1114957726 14:27845402-27845424 GGCCAACGCAAGTTCCGGGTGGG + Intergenic
1115172897 14:30528945-30528967 TGGCCACTGAAGCTCCCTGTGGG - Intergenic
1121021849 14:90585074-90585096 GGCCGAGGGAAGCTCAGGGTAGG - Intronic
1122799054 14:104220820-104220842 GGCCCACGACAGCTCCCTCTCGG - Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1125859649 15:42986886-42986908 AGCCCAGGGAAGCTCCGGGTGGG - Intronic
1129323914 15:74789617-74789639 GGCCCAGGGAACCTCCGAGCAGG - Intronic
1130872426 15:87982042-87982064 GGCCCTGGAAAGATCCGTGTCGG + Intronic
1132461355 16:56721-56743 GCCCCAAGGAAGCTCCTTGGAGG - Intronic
1136064507 16:27749704-27749726 GTCCCCCGGGAGCTCCGTGTTGG - Exonic
1136910679 16:34141882-34141904 GGCTCACGAAAGCCCCATGTGGG + Intergenic
1136910767 16:34142520-34142542 GGCTCACGAAAGCCCCATGTGGG - Intergenic
1141667035 16:85470977-85470999 GGCCCACTGAAGCTTGGTGCTGG + Intergenic
1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG + Exonic
1143956973 17:10678190-10678212 GGCATACGGAACCTCCGTTTTGG + Exonic
1146456532 17:33013779-33013801 GGCCCAAGGATGCGTCGTGTTGG + Exonic
1147460122 17:40562997-40563019 GGCCCATTGCAGCTCCTTGTTGG + Intronic
1152603865 17:81279038-81279060 GGGCCAGGGATGCTCCGTCTGGG - Intronic
1152748332 17:82051403-82051425 GGCCCCCGGAGGCTCCGCGCGGG - Intronic
1154338198 18:13482425-13482447 AGCACACGGAAGCTCTGTATTGG + Intronic
1157114597 18:44851255-44851277 GGCCCAGGAAAGCTTCCTGTAGG + Intronic
1157740622 18:50089786-50089808 GGCCCAGGGAATCGCCTTGTTGG - Intronic
1165480173 19:36058660-36058682 TGGCCACAGAAGCTCAGTGTGGG + Intronic
1167107261 19:47437603-47437625 GAACCAGGGAAGCTCCATGTTGG + Intronic
934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG + Intergenic
946741435 2:222806190-222806212 GGCCCACAGAAAATCAGTGTCGG - Intergenic
948242793 2:236452314-236452336 GGCCCGTTGAAGCTCAGTGTTGG - Intronic
1169056227 20:2623896-2623918 GCCCAAAGGAAGCTCCATGTTGG + Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1182356830 22:29726007-29726029 GGCCCAGGAAAGCTCCAGGTGGG + Intronic
1183868586 22:40723584-40723606 GGGCCAGGGAGGCTTCGTGTGGG + Intergenic
1184023083 22:41833693-41833715 GGACCACGGAAACCGCGTGTGGG - Intronic
1184694094 22:46130279-46130301 GGCCCATGCATGCTCCCTGTAGG - Intergenic
1184728174 22:46358094-46358116 AGCCCAGGGAGGCTCCGTGCTGG - Intergenic
1185315144 22:50175745-50175767 GGCAGCCGGGAGCTCCGTGTGGG + Intronic
950270964 3:11614537-11614559 TGCCCACTGCAGCTCCGTGGGGG - Intronic
957677962 3:83394292-83394314 CTCCCATGGAAGCTCAGTGTGGG + Intergenic
957970363 3:87375362-87375384 GGCCAGCGCAAGCTCCGGGTGGG + Intergenic
967319776 3:188184037-188184059 GGACCACGGTACCTCCTTGTGGG + Intronic
968878671 4:3287573-3287595 GGCCCGAGGAAGTTCTGTGTAGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
997207175 5:132056780-132056802 GGCTCACGGAAGCGCTGTGGTGG + Intergenic
999079966 5:148833950-148833972 GGCCCATGGACGATCTGTGTTGG - Intergenic
1001408620 5:171494925-171494947 GGCCCAGGGAAGCCCCTTGTAGG - Intergenic
1001804733 5:174573650-174573672 GACCCACGGAGGCTGCTTGTGGG + Intergenic
1006801020 6:36759694-36759716 GGTCCACGGAGCCTCCCTGTGGG - Intronic
1012788437 6:103660730-103660752 TGCACACGGAAGCTCCACGTAGG + Intergenic
1014499288 6:122165373-122165395 GGCCAACACAAGTTCCGTGTGGG - Intergenic
1018503960 6:164443827-164443849 GGCCCACAGCAGCTACATGTGGG - Intergenic
1019448563 7:1084153-1084175 GTCCCAAGGAAGCTGTGTGTGGG - Intronic
1019610276 7:1933223-1933245 GGCCCAGGGATACTCCGGGTAGG + Intronic
1020277187 7:6631859-6631881 GGCACACAGAGGCTCCGTGGGGG + Intergenic
1027956027 7:84880625-84880647 GGCCCGCGCAAGTTCCGGGTGGG + Intergenic
1034424737 7:151008634-151008656 GGCACACGGTAGCTCTGTGAAGG - Intronic
1034514300 7:151562287-151562309 GGGCCACGGCAGCTCTGTGCCGG + Intronic
1036643887 8:10600522-10600544 TCACCACGGAAGCTCCTTGTTGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1061644534 9:131990091-131990113 GGGCCAGGGAAGCACCGTCTGGG - Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1186433408 X:9523401-9523423 GGCCCACGGTGGCCCAGTGTGGG - Intronic
1191725219 X:64272065-64272087 GGCCCACAGAAGCTCTGGCTTGG + Intronic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic
1201179700 Y:11332936-11332958 GGCTCACAAAAGCTCCCTGTGGG - Intergenic