ID: 1067214838

View in Genome Browser
Species Human (GRCh38)
Location 10:44293223-44293245
Sequence GGCCCACGGAAGCTCCGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067214833_1067214838 8 Left 1067214833 10:44293192-44293214 CCAGTGTACTTCTCCTGGGGGCT 0: 1
1: 0
2: 0
3: 19
4: 149
Right 1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 110
1067214832_1067214838 9 Left 1067214832 10:44293191-44293213 CCCAGTGTACTTCTCCTGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 110
1067214835_1067214838 -5 Left 1067214835 10:44293205-44293227 CCTGGGGGCTCCTTTCTAGGCCC 0: 1
1: 0
2: 1
3: 23
4: 177
Right 1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067214838 Original CRISPR GGCCCACGGAAGCTCCGTGT TGG Intronic