ID: 1067214974

View in Genome Browser
Species Human (GRCh38)
Location 10:44293833-44293855
Sequence CCACCTGAGGGCCCCCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067214974 Original CRISPR CCACCTGAGGGCCCCCTGAA AGG Intronic
900138632 1:1129307-1129329 CCCTCTGAGGGCCCCCTGGCTGG - Intergenic
900990774 1:6097211-6097233 CCACCACAGGGGCCCCTGATGGG - Intronic
901059395 1:6465196-6465218 CTACCTGAAGGCCCCTTGCACGG - Exonic
901443726 1:9294387-9294409 GAACCAGAGGGCCCCCTGGATGG - Intronic
902092794 1:13916755-13916777 CCACCTGGGGAGCCACTGAAAGG + Intergenic
902280027 1:15367604-15367626 CAACCTGAGTGCCTCCTCAAGGG - Exonic
902409702 1:16205732-16205754 CCCCCTGAGGACCCCGTGGATGG - Intronic
902601251 1:17541039-17541061 CAGCCTGAGGGCCCGATGAAGGG - Intronic
903287625 1:22286628-22286650 CCAACTGAGGGCCCCCTCACTGG - Intergenic
904318317 1:29680323-29680345 CTACCTGAGTGCTCCCTGGATGG + Intergenic
905279856 1:36842110-36842132 CCAGCTGGGGGCCTCATGAATGG + Intronic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
908115401 1:60935277-60935299 CCTGCTGAGAGCACCCTGAATGG - Intronic
911170743 1:94768801-94768823 CTGCCAGAGGGGCCCCTGAAGGG + Intergenic
912209768 1:107545133-107545155 CCAGCTGAGGGACCCCTGAGAGG + Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
914899667 1:151705027-151705049 CCACCTGGGGGCCCTCAGTAGGG + Exonic
919496490 1:198276857-198276879 CCAGCTGAGGGCAGGCTGAATGG - Intronic
920059456 1:203217473-203217495 CCTCCAGAGGGCCCCCAGACTGG - Intronic
922930539 1:229385756-229385778 CCTCCTGTGAGCCCCCTTAAAGG - Intergenic
923357678 1:233176668-233176690 CCACCTGAGGGCCACCTAAGTGG + Intronic
1063430597 10:5985024-5985046 CCACCTGAGTCTCTCCTGAATGG - Intergenic
1064490744 10:15853310-15853332 CTTCCAGTGGGCCCCCTGAAAGG - Intronic
1065849495 10:29775482-29775504 CCACCTGAGAGCCACCTGGGAGG - Intergenic
1066651593 10:37661261-37661283 CCACCTGAGGGGTGCCTGCAGGG + Intergenic
1067054998 10:43045137-43045159 CCTCCTGAGGACCCTCAGAAAGG + Intergenic
1067161006 10:43825374-43825396 CCACCTGAGGGGCCCCCTGAAGG - Intergenic
1067214974 10:44293833-44293855 CCACCTGAGGGCCCCCTGAAAGG + Intronic
1070794156 10:79207307-79207329 CCTCCTGAAGGACCCCTGGAGGG - Intronic
1073033572 10:100547481-100547503 CCATCTGGGGACCCCCTGAGGGG + Intronic
1076280526 10:129242572-129242594 CCACGTGAAGTCCCCCGGAATGG + Intergenic
1077539309 11:3139157-3139179 TCACCCCAGGGTCCCCTGAACGG - Intronic
1077571882 11:3346397-3346419 CCACCTCAGGGCGCCCTGAGAGG - Intronic
1079416652 11:20244162-20244184 CCACCAGAGGGCCCTGTGCAGGG + Intergenic
1082012506 11:47459644-47459666 CCACCTTAGTGACCCCTCAAAGG + Intergenic
1083268051 11:61556076-61556098 GCTCCTGAGGGCCCCTTGGAGGG - Intronic
1083628473 11:64084009-64084031 CCTCCTGAGGGACCAGTGAAAGG - Intronic
1084892761 11:72244463-72244485 CCACCTGCGGCCCCGCGGAAGGG + Intronic
1088745063 11:112798104-112798126 GCACCTGACCGCCCCCTGCAGGG - Intergenic
1088815123 11:113415420-113415442 CCACCTGAGGGCTCCACTAAAGG - Exonic
1091986684 12:4915254-4915276 CCACCTCAGGGTCCTTTGAAAGG - Exonic
1092160349 12:6312245-6312267 CCACATGAGGGCCCCCTCCAAGG + Exonic
1097226182 12:57477929-57477951 CCACCTCAGGGCCACAGGAAAGG + Intronic
1097288667 12:57896506-57896528 CCCACCGAGGACCCCCTGAACGG + Intergenic
1099980704 12:89598687-89598709 CCGCCTTAGAGCCCCCTGAATGG + Intronic
1102472924 12:113169766-113169788 TCACCTGAGGGCTCCTTGAGGGG + Exonic
1105001975 12:132695942-132695964 CCTCCTGAGGTCCCCCTGGCAGG + Exonic
1105624883 13:22103184-22103206 CCTCATGAGGGCCCCCTGCTGGG + Intergenic
1108478300 13:50842970-50842992 CCACCTGAGGCCCGCCTGGCTGG - Intronic
1108510142 13:51148574-51148596 TCCCCTGAGGTCCCCCTGGAGGG + Intergenic
1110984506 13:81947758-81947780 CCACCAGAGGTCCACGTGAAAGG - Intergenic
1117224092 14:53637310-53637332 CCCCCTGAGTGCTCCCTGCAGGG - Intergenic
1118319314 14:64743790-64743812 CCACCTGAGGGCCCTGGGCAGGG - Exonic
1122207886 14:100157244-100157266 CTACCTCAGGGCCACCTGGAGGG - Intronic
1122245652 14:100401503-100401525 CAACCTGAGGCAGCCCTGAACGG - Intronic
1122811476 14:104291473-104291495 CCGCCCCAGGGACCCCTGAAGGG - Intergenic
1122914549 14:104852099-104852121 CCACCAGAGGCCCCTCTGAGAGG + Intergenic
1123681120 15:22764855-22764877 CAACCTGATTGCCCACTGAAGGG - Intergenic
1128131278 15:65228645-65228667 CCAACTGAGGGCACACTGAAAGG + Intergenic
1128158950 15:65410612-65410634 CCTCCTGAGAGCCCCCTAAGGGG + Intronic
1129110358 15:73333591-73333613 CCACCTGTGGCCCCCATCAAGGG + Intronic
1130966954 15:88705112-88705134 ACACCTGTTGGCCCCCTGCAGGG - Intergenic
1132198285 15:99930357-99930379 ACACCTGAGGATCCCCTGGAGGG - Intergenic
1132375021 15:101323228-101323250 CCACCTGTGGGGGCCCTGAGGGG - Intronic
1134167311 16:11941252-11941274 CCGCCTCAGGGCGCCCTGAAAGG - Intronic
1134493386 16:14712431-14712453 CCGCCTCAGGGAGCCCTGAAAGG + Intronic
1134498767 16:14751555-14751577 CCGCCTCAGGGAGCCCTGAAAGG + Intronic
1134525320 16:14938184-14938206 CCACCTCCGGGTGCCCTGAAAGG + Intronic
1134547574 16:15122724-15122746 CCACCTCCGGGCGCCCTGAAAGG - Intronic
1134712907 16:16336668-16336690 CTGCCTCAGGGCGCCCTGAAAGG + Intergenic
1134720773 16:16379986-16380008 CTGCCTCAGGGCGCCCTGAAAGG + Intronic
1134946654 16:18331899-18331921 CTGCCTCAGGGCGCCCTGAAAGG - Intronic
1134953913 16:18372014-18372036 CTGCCTCAGGGCGCCCTGAAAGG - Intergenic
1135221770 16:20620780-20620802 CCACCTCAGGGTGCCCTGAGAGG - Intronic
1135312735 16:21418892-21418914 CCGCCTCAGGGCGCCCTGAAAGG - Intronic
1135365652 16:21851162-21851184 CCGCCTCAGGGCGCCCTGAAAGG - Intronic
1135446156 16:22519990-22520012 CCGCCTCAGGGCGCCCTGAAAGG + Intronic
1135665040 16:24328685-24328707 GGACCTGACGGCCCCGTGAAGGG + Intronic
1136151878 16:28356610-28356632 CCGCCTCAGGGCACCCTGAAAGG - Intronic
1136168113 16:28470447-28470469 CCGCCTCAGGGCACCCTGAAAGG - Intronic
1136194858 16:28644559-28644581 ACACCTCAGGGCGCCCTGAAAGG + Intronic
1136211201 16:28758673-28758695 CCGCCTCAGGGCACCCTGAAAGG + Intronic
1136255921 16:29038624-29038646 CCGCCTCAGGGCGCCCTGAAAGG + Exonic
1136309412 16:29397651-29397673 ACGCCTCAGGGCGCCCTGAAAGG - Intronic
1136322853 16:29499407-29499429 CCGCCTCAGGGCGCCCTGAAAGG - Intronic
1136437537 16:30239375-30239397 CCGCCTCAGGGCGCCCTGAAAGG - Intronic
1138436081 16:57000837-57000859 CCTCCCAAGGGACCCCTGAAAGG + Intronic
1139857103 16:69990039-69990061 CTGCCTCAGGGCGCCCTGAAAGG - Intergenic
1140365610 16:74377943-74377965 CCGCCTCAGGGCGCCCTGAAAGG + Exonic
1142166480 16:88592419-88592441 TGACCTCAGGGTCCCCTGAAAGG - Intronic
1142274145 16:89107148-89107170 AGACCTGGAGGCCCCCTGAAGGG - Intronic
1142559947 17:803904-803926 CCGCCTGAGCGGCCCCTGAACGG + Intronic
1142848270 17:2692357-2692379 TCACCTGAGGGCCACCTTGAGGG + Exonic
1144863326 17:18319264-18319286 CCACCTGAGAGCCATCGGAAGGG + Intronic
1147157991 17:38554233-38554255 CCACCTGATGGCCCCCATGAAGG - Intronic
1147917607 17:43898138-43898160 GCACAAGAGGCCCCCCTGAAGGG - Intronic
1149629908 17:58114154-58114176 CCACCCGAGGTCCTTCTGAAAGG - Intergenic
1151332538 17:73419190-73419212 CCTCCTGAGAGCCACCAGAATGG - Exonic
1151784459 17:76268569-76268591 CCCCCTGAGGACCCCTAGAAAGG + Intronic
1152699330 17:81811310-81811332 CTACCTGAGGCCCCCCAGGATGG - Exonic
1154118587 18:11633359-11633381 CCGCCTCAGGGCGCCCTGAGAGG - Intergenic
1157335862 18:46736927-46736949 GGACCTGTGGGCCCCCTGGAAGG + Intronic
1160446123 18:78928077-78928099 CCACGTGAGGACACCTTGAAAGG + Intergenic
1163639020 19:18451127-18451149 CCAGCTGAGGCCACCCTGAGCGG - Intronic
1164753864 19:30675331-30675353 CTACCTGATGGACCCCTCAAAGG + Intronic
1165159905 19:33810023-33810045 CCACCTGCTGGCCGCCTGGAGGG - Intronic
925449269 2:3954054-3954076 CCACCTGAGCATCCCCAGAACGG - Intergenic
932467890 2:71935099-71935121 CAACCTGAGGGCCTCCTGGTAGG - Intergenic
934690159 2:96352404-96352426 TCTCCTCAGGGCCCCCTGGATGG - Intronic
934936624 2:98470335-98470357 CCACCTGGGGTTCCCCTGATTGG + Intronic
935139542 2:100340471-100340493 CCACCTGAGAGGCCCCGGTAAGG + Intergenic
938539674 2:132275711-132275733 CCGCCTCAGAGCTCCCTGAAAGG + Intergenic
939992483 2:148888406-148888428 CCACCACAGGGCCCCCTAATGGG - Intronic
944669691 2:201984655-201984677 CCAGCTGAGGGCCTCATCAAAGG - Intergenic
945037995 2:205720739-205720761 ACTCCTGAGGGCCTCCTCAATGG - Intronic
946112259 2:217430333-217430355 CCACCTGAGTGATCCATGAATGG - Intronic
946433426 2:219637614-219637636 CCCCCTGAGGGGGCCCTGGAGGG + Exonic
947751626 2:232535584-232535606 CCCCCTGAGGCCACCCTGAGTGG - Exonic
1169553236 20:6722823-6722845 CCTCATGAGGGTGCCCTGAAGGG + Intergenic
1170962428 20:21037343-21037365 CCACCTCAGCGCCACCTGCAAGG - Intergenic
1172765505 20:37348625-37348647 CCACCTCAGGGCCCCTGGGAAGG - Intronic
1173819234 20:46010053-46010075 CCACTTGAGGTCGCCCTCAAAGG - Exonic
1175097452 20:56552741-56552763 GAGCCTGAGGACCCCCTGAAGGG - Intergenic
1175955725 20:62608151-62608173 CCTCCTGAGGGTCCCCTGCATGG - Intergenic
1176013111 20:62911065-62911087 CCCACTGAGAGGCCCCTGAAAGG - Exonic
1180971254 22:19816931-19816953 CCACCTCAGTGCCCCTTGGATGG - Intronic
1181093143 22:20487909-20487931 GGAGCTGAGGGCCCCCTGCAGGG - Intronic
1182150044 22:28021409-28021431 CCACCTGAGGAACGCATGAAGGG + Intronic
1185013645 22:48331196-48331218 CCAGCTGCTGGGCCCCTGAAAGG + Intergenic
1185332125 22:50256566-50256588 CCACCTCAGGGCCCCCTGCCAGG + Intronic
949226440 3:1700580-1700602 CTACGTGTGGGCTCCCTGAAGGG - Intergenic
950096997 3:10336244-10336266 TCTCCGCAGGGCCCCCTGAAAGG + Intronic
953021158 3:39114277-39114299 CCATGTGAGGTCACCCTGAAGGG - Intronic
957201969 3:77147327-77147349 CCACTTGAGGGGGCCCTAAAGGG + Intronic
962499492 3:135975375-135975397 CCACCAGAGGGCCCACATAAAGG - Intronic
967993664 3:195150704-195150726 CCGCCTGAGGATCCTCTGAATGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
976733934 4:88291672-88291694 CCACATGAGGGACCTCTGTATGG + Intergenic
979500996 4:121439732-121439754 CCACCTGAGGGCCCAAAGACAGG - Intergenic
985714060 5:1445869-1445891 CCACCGTAGGGGCCCCTGATGGG - Intergenic
986709118 5:10475062-10475084 CCACCTGAGAGGCTTCTGAAGGG - Intergenic
987640656 5:20607463-20607485 CCTCCTCAGGGCCTCCAGAAAGG + Intergenic
993565059 5:89463774-89463796 CCACATGAGGGAACACTGAAGGG + Intergenic
994449864 5:99928878-99928900 CCACGTCTGGGCTCCCTGAAGGG + Intergenic
995531614 5:113096663-113096685 CCACCTAAGAGCCCACTCAAAGG - Intronic
998231840 5:140365867-140365889 CCACCTGAGTGCACCCGGCAGGG + Exonic
1002346522 5:178551759-178551781 CCAACAGAGGGGCCCCTGAGGGG - Intronic
1002575890 5:180173401-180173423 CCACCTCAGGGTCCCCTTCATGG - Intronic
1002635989 5:180609086-180609108 CCGCCTGAGGCCCTCCTGCAGGG + Intronic
1005818642 6:29578532-29578554 CCCCTTGGGGGACCCCTGAATGG + Intronic
1006127306 6:31847717-31847739 CCACCTGAGGTTCACCTGACTGG - Intergenic
1006318393 6:33304522-33304544 CCACCTCCAGGCCCCCAGAAGGG + Exonic
1007246239 6:40465216-40465238 CTACCCTAGAGCCCCCTGAAAGG + Intronic
1007321812 6:41033222-41033244 CCACCTGAGGGGCCTCTGTGGGG + Intronic
1007548225 6:42709893-42709915 CCACCTTAGGGCCACCTGGTAGG - Intronic
1010613549 6:77985277-77985299 CCACCTGAGGGCCCAGAGACTGG + Intergenic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1015851340 6:137575631-137575653 CCTTCTGGGGGCCCCCTTAAAGG + Intergenic
1018696609 6:166396236-166396258 CCTCCTGAGGGACCCCTGCTGGG - Intergenic
1018929562 6:168231921-168231943 CCCTCTGTGGGCCCCCTGAAGGG + Intergenic
1019047393 6:169159536-169159558 CTCCCTGAGGGCCCACTGATTGG + Intergenic
1019856761 7:3616488-3616510 CCACCAGAGGGCCTGCTTAACGG + Intronic
1023911545 7:44560184-44560206 CTTCCTGAGGGCTCCCTGAATGG + Intergenic
1027151902 7:75739105-75739127 CCAGCGGAGGGGCTCCTGAAGGG - Intergenic
1029988769 7:104944313-104944335 CCATCTGGGGACCCCCTCAAAGG + Intergenic
1034279711 7:149844533-149844555 CCACCTGAGGGCACCCTACACGG - Intronic
1035208496 7:157310432-157310454 TCACCTGAGGCCCCGCAGAATGG + Intergenic
1036746339 8:11412719-11412741 CCTGCTTTGGGCCCCCTGAAGGG + Intronic
1036760702 8:11506815-11506837 CCACCTGGGGGGCCCCAGAGTGG - Intronic
1037014131 8:13881621-13881643 CCACCTGTGGCCCTCCAGAATGG - Intergenic
1038215957 8:25561953-25561975 CCAACTGTGGGCACCCTGAAAGG - Intergenic
1038262641 8:26010340-26010362 CGCCCTGATGGGCCCCTGAAAGG - Intronic
1040903286 8:52439337-52439359 CCTCCTGAGGCCTTCCTGAAAGG - Intronic
1045510442 8:102808670-102808692 CCGCCTTGGGGCCCCCTGCAGGG - Intergenic
1046711743 8:117518533-117518555 CCTTCTGAGAGCCCCCAGAAGGG + Intergenic
1048816543 8:138339802-138339824 CCACCTGAGTGTCCTCTGCAGGG + Intronic
1048944147 8:139428865-139428887 CCACCTGAGGGTCCCCTAAAAGG - Intergenic
1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG + Intronic
1053489175 9:38487029-38487051 GCACCTGGGAGCCCCCTGACTGG - Intergenic
1057669530 9:97076343-97076365 GCACCTGGGAGCCCCCTGACTGG - Intergenic
1059406142 9:114099100-114099122 CCACCTGAGCACCACCTGGATGG + Intronic
1060846661 9:126842728-126842750 CCACGTGAGGTCCGCCTGACAGG + Intergenic
1061667834 9:132170611-132170633 CCACCTGTGGTCCCCGTGAGAGG + Intronic
1062571138 9:137185909-137185931 CCACCAGAGGAGCCACTGAATGG - Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1197221570 X:123919494-123919516 AAATCTGAGGGCCCCTTGAATGG - Intergenic
1198973016 X:142302669-142302691 CCACCACAGGGACCCCAGAATGG - Intergenic
1200316342 X:155136960-155136982 CCCGCTGAGGGCTCCCTGCAGGG + Intronic