ID: 1067221376

View in Genome Browser
Species Human (GRCh38)
Location 10:44346598-44346620
Sequence CCCCTCAGCGGTGAAACCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067221376_1067221384 12 Left 1067221376 10:44346598-44346620 CCGCAGGTTTCACCGCTGAGGGG No data
Right 1067221384 10:44346633-44346655 TTCATGAAGGCATTCACTCAGGG No data
1067221376_1067221383 11 Left 1067221376 10:44346598-44346620 CCGCAGGTTTCACCGCTGAGGGG No data
Right 1067221383 10:44346632-44346654 CTTCATGAAGGCATTCACTCAGG No data
1067221376_1067221380 -1 Left 1067221376 10:44346598-44346620 CCGCAGGTTTCACCGCTGAGGGG No data
Right 1067221380 10:44346620-44346642 GATGCTGGAGCCCTTCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067221376 Original CRISPR CCCCTCAGCGGTGAAACCTG CGG (reversed) Intergenic
No off target data available for this crispr