ID: 1067221380

View in Genome Browser
Species Human (GRCh38)
Location 10:44346620-44346642
Sequence GATGCTGGAGCCCTTCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067221376_1067221380 -1 Left 1067221376 10:44346598-44346620 CCGCAGGTTTCACCGCTGAGGGG No data
Right 1067221380 10:44346620-44346642 GATGCTGGAGCCCTTCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067221380 Original CRISPR GATGCTGGAGCCCTTCATGA AGG Intergenic
No off target data available for this crispr