ID: 1067221383

View in Genome Browser
Species Human (GRCh38)
Location 10:44346632-44346654
Sequence CTTCATGAAGGCATTCACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067221376_1067221383 11 Left 1067221376 10:44346598-44346620 CCGCAGGTTTCACCGCTGAGGGG No data
Right 1067221383 10:44346632-44346654 CTTCATGAAGGCATTCACTCAGG No data
1067221379_1067221383 -1 Left 1067221379 10:44346610-44346632 CCGCTGAGGGGATGCTGGAGCCC No data
Right 1067221383 10:44346632-44346654 CTTCATGAAGGCATTCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067221383 Original CRISPR CTTCATGAAGGCATTCACTC AGG Intergenic
No off target data available for this crispr