ID: 1067221622

View in Genome Browser
Species Human (GRCh38)
Location 10:44348106-44348128
Sequence TCCAGGGCATGGAGCTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067221622_1067221635 23 Left 1067221622 10:44348106-44348128 CCCTGAGAGCTCCATGCCCTGGA No data
Right 1067221635 10:44348152-44348174 AAGGCACTGAACCTGGACATAGG No data
1067221622_1067221632 4 Left 1067221622 10:44348106-44348128 CCCTGAGAGCTCCATGCCCTGGA No data
Right 1067221632 10:44348133-44348155 GGCCTCTGTGAGGGAGGGAAAGG No data
1067221622_1067221628 -6 Left 1067221622 10:44348106-44348128 CCCTGAGAGCTCCATGCCCTGGA No data
Right 1067221628 10:44348123-44348145 CCTGGAGAAAGGCCTCTGTGAGG No data
1067221622_1067221630 -2 Left 1067221622 10:44348106-44348128 CCCTGAGAGCTCCATGCCCTGGA No data
Right 1067221630 10:44348127-44348149 GAGAAAGGCCTCTGTGAGGGAGG No data
1067221622_1067221631 -1 Left 1067221622 10:44348106-44348128 CCCTGAGAGCTCCATGCCCTGGA No data
Right 1067221631 10:44348128-44348150 AGAAAGGCCTCTGTGAGGGAGGG No data
1067221622_1067221629 -5 Left 1067221622 10:44348106-44348128 CCCTGAGAGCTCCATGCCCTGGA No data
Right 1067221629 10:44348124-44348146 CTGGAGAAAGGCCTCTGTGAGGG No data
1067221622_1067221634 16 Left 1067221622 10:44348106-44348128 CCCTGAGAGCTCCATGCCCTGGA No data
Right 1067221634 10:44348145-44348167 GGAGGGAAAGGCACTGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067221622 Original CRISPR TCCAGGGCATGGAGCTCTCA GGG (reversed) Intergenic
No off target data available for this crispr