ID: 1067221635

View in Genome Browser
Species Human (GRCh38)
Location 10:44348152-44348174
Sequence AAGGCACTGAACCTGGACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067221633_1067221635 -6 Left 1067221633 10:44348135-44348157 CCTCTGTGAGGGAGGGAAAGGCA No data
Right 1067221635 10:44348152-44348174 AAGGCACTGAACCTGGACATAGG No data
1067221623_1067221635 22 Left 1067221623 10:44348107-44348129 CCTGAGAGCTCCATGCCCTGGAG No data
Right 1067221635 10:44348152-44348174 AAGGCACTGAACCTGGACATAGG No data
1067221625_1067221635 12 Left 1067221625 10:44348117-44348139 CCATGCCCTGGAGAAAGGCCTCT No data
Right 1067221635 10:44348152-44348174 AAGGCACTGAACCTGGACATAGG No data
1067221626_1067221635 7 Left 1067221626 10:44348122-44348144 CCCTGGAGAAAGGCCTCTGTGAG No data
Right 1067221635 10:44348152-44348174 AAGGCACTGAACCTGGACATAGG No data
1067221627_1067221635 6 Left 1067221627 10:44348123-44348145 CCTGGAGAAAGGCCTCTGTGAGG No data
Right 1067221635 10:44348152-44348174 AAGGCACTGAACCTGGACATAGG No data
1067221622_1067221635 23 Left 1067221622 10:44348106-44348128 CCCTGAGAGCTCCATGCCCTGGA No data
Right 1067221635 10:44348152-44348174 AAGGCACTGAACCTGGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067221635 Original CRISPR AAGGCACTGAACCTGGACAT AGG Intergenic
No off target data available for this crispr