ID: 1067222288

View in Genome Browser
Species Human (GRCh38)
Location 10:44352894-44352916
Sequence TTCGATATTTCACACCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067222288_1067222298 30 Left 1067222288 10:44352894-44352916 CCATTCAGGTGTGAAATATCGAA No data
Right 1067222298 10:44352947-44352969 GACACAGATGGAGAAAGGCAAGG No data
1067222288_1067222291 6 Left 1067222288 10:44352894-44352916 CCATTCAGGTGTGAAATATCGAA No data
Right 1067222291 10:44352923-44352945 TCCTGCTCCTTCTAGGGCCCTGG No data
1067222288_1067222289 -1 Left 1067222288 10:44352894-44352916 CCATTCAGGTGTGAAATATCGAA No data
Right 1067222289 10:44352916-44352938 ACTGTTCTCCTGCTCCTTCTAGG No data
1067222288_1067222290 0 Left 1067222288 10:44352894-44352916 CCATTCAGGTGTGAAATATCGAA No data
Right 1067222290 10:44352917-44352939 CTGTTCTCCTGCTCCTTCTAGGG No data
1067222288_1067222297 25 Left 1067222288 10:44352894-44352916 CCATTCAGGTGTGAAATATCGAA No data
Right 1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG No data
1067222288_1067222294 18 Left 1067222288 10:44352894-44352916 CCATTCAGGTGTGAAATATCGAA No data
Right 1067222294 10:44352935-44352957 TAGGGCCCTGGTGACACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067222288 Original CRISPR TTCGATATTTCACACCTGAA TGG (reversed) Intergenic
No off target data available for this crispr