ID: 1067222297

View in Genome Browser
Species Human (GRCh38)
Location 10:44352942-44352964
Sequence CTGGTGACACAGATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067222292_1067222297 -5 Left 1067222292 10:44352924-44352946 CCTGCTCCTTCTAGGGCCCTGGT No data
Right 1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG No data
1067222288_1067222297 25 Left 1067222288 10:44352894-44352916 CCATTCAGGTGTGAAATATCGAA No data
Right 1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067222297 Original CRISPR CTGGTGACACAGATGGAGAA AGG Intergenic
No off target data available for this crispr