ID: 1067222487

View in Genome Browser
Species Human (GRCh38)
Location 10:44353934-44353956
Sequence TCCCCATGGCTGCCCATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067222482_1067222487 1 Left 1067222482 10:44353910-44353932 CCATCTTAGAGGATTATCCCTGT No data
Right 1067222487 10:44353934-44353956 TCCCCATGGCTGCCCATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067222487 Original CRISPR TCCCCATGGCTGCCCATGGC AGG Intergenic
No off target data available for this crispr