ID: 1067223439

View in Genome Browser
Species Human (GRCh38)
Location 10:44360381-44360403
Sequence CAGTGTGCGCTGTGGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067223439_1067223447 30 Left 1067223439 10:44360381-44360403 CCTGACTCCCACAGCGCACACTG No data
Right 1067223447 10:44360434-44360456 CCCTGCCTGACCTGCAGCTAAGG No data
1067223439_1067223445 -10 Left 1067223439 10:44360381-44360403 CCTGACTCCCACAGCGCACACTG No data
Right 1067223445 10:44360394-44360416 GCGCACACTGGGGAAAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067223439 Original CRISPR CAGTGTGCGCTGTGGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr