ID: 1067224361

View in Genome Browser
Species Human (GRCh38)
Location 10:44365841-44365863
Sequence GCTGCCAGTCAGCCCCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067224361_1067224365 13 Left 1067224361 10:44365841-44365863 CCAGCATGGGGCTGACTGGCAGC No data
Right 1067224365 10:44365877-44365899 AGCTCCAGCACATGAGCCAAAGG No data
1067224361_1067224367 24 Left 1067224361 10:44365841-44365863 CCAGCATGGGGCTGACTGGCAGC No data
Right 1067224367 10:44365888-44365910 ATGAGCCAAAGGAATGCTCATGG No data
1067224361_1067224369 30 Left 1067224361 10:44365841-44365863 CCAGCATGGGGCTGACTGGCAGC No data
Right 1067224369 10:44365894-44365916 CAAAGGAATGCTCATGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067224361 Original CRISPR GCTGCCAGTCAGCCCCATGC TGG (reversed) Intergenic
No off target data available for this crispr