ID: 1067225366

View in Genome Browser
Species Human (GRCh38)
Location 10:44372852-44372874
Sequence CTGTGGGATGGGATGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 2, 2: 4, 3: 69, 4: 782}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067225366_1067225381 30 Left 1067225366 10:44372852-44372874 CCCTCCACCATCCCATCCCACAG 0: 1
1: 2
2: 4
3: 69
4: 782
Right 1067225381 10:44372905-44372927 TGACTGGTCCTGGCACCCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 199
1067225366_1067225375 6 Left 1067225366 10:44372852-44372874 CCCTCCACCATCCCATCCCACAG 0: 1
1: 2
2: 4
3: 69
4: 782
Right 1067225375 10:44372881-44372903 GCCTTCACTAGGCTTTGCCCAGG 0: 1
1: 0
2: 3
3: 21
4: 156
1067225366_1067225374 -5 Left 1067225366 10:44372852-44372874 CCCTCCACCATCCCATCCCACAG 0: 1
1: 2
2: 4
3: 69
4: 782
Right 1067225374 10:44372870-44372892 CACAGAGAGAAGCCTTCACTAGG 0: 1
1: 0
2: 1
3: 16
4: 223
1067225366_1067225377 14 Left 1067225366 10:44372852-44372874 CCCTCCACCATCCCATCCCACAG 0: 1
1: 2
2: 4
3: 69
4: 782
Right 1067225377 10:44372889-44372911 TAGGCTTTGCCCAGGTTGACTGG 0: 1
1: 0
2: 0
3: 15
4: 108
1067225366_1067225378 20 Left 1067225366 10:44372852-44372874 CCCTCCACCATCCCATCCCACAG 0: 1
1: 2
2: 4
3: 69
4: 782
Right 1067225378 10:44372895-44372917 TTGCCCAGGTTGACTGGTCCTGG 0: 1
1: 0
2: 2
3: 15
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067225366 Original CRISPR CTGTGGGATGGGATGGTGGA GGG (reversed) Intronic
900016806 1:156862-156884 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
900047066 1:515454-515476 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
900069270 1:757169-757191 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
900195780 1:1374895-1374917 TTGTGGGTTGGGGTGGCGGAGGG - Exonic
900338258 1:2175472-2175494 CTGGGGGTTGGGTTGGTGGTGGG - Intronic
901118832 1:6873486-6873508 CTGAGGGATGAGCTGGTTGATGG + Intronic
901247124 1:7740553-7740575 CTGTGGGAAGGTCTAGTGGATGG - Intronic
901263109 1:7888321-7888343 CTGAGGGATGGGGAGGAGGAAGG - Intergenic
901638483 1:10681276-10681298 AGGTGGGTCGGGATGGTGGAAGG + Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902568445 1:17331163-17331185 CTGTGGGGTGGCAGTGTGGATGG + Intronic
903204865 1:21773892-21773914 CTTTGGGAGGGCAAGGTGGAAGG + Intronic
903213668 1:21831748-21831770 CAGTGGTGTGGGATGGCGGATGG + Exonic
903694086 1:25194833-25194855 CAGTGTCATGAGATGGTGGAAGG + Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
905034865 1:34911462-34911484 CTGTGTCCTGGGATAGTGGATGG - Intronic
905175292 1:36131389-36131411 CTTTGGGAAGGGAAGGTAGAAGG + Intergenic
905238379 1:36566014-36566036 CTGGGGAATGGGATGGATGATGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905672103 1:39798609-39798631 CTGTGGTAAAGGGTGGTGGATGG + Intergenic
906203856 1:43976472-43976494 TTGTGGGATGGGATGTTATAGGG + Intronic
907194447 1:52675255-52675277 TGGTGGGATGGGATGGTGGTGGG - Intergenic
907220697 1:52905118-52905140 CTGGGGGACCGGATGGGGGAGGG - Intronic
907248053 1:53120567-53120589 GTTGGGGAAGGGATGGTGGATGG - Intronic
907388349 1:54140111-54140133 ATGGGGGATGGGGAGGTGGAAGG + Intronic
907834082 1:58092818-58092840 CTGAGGAATGGCACGGTGGATGG - Intronic
908112807 1:60914063-60914085 TTGTGGGATGGGGTGGAGGGGGG + Intronic
908224682 1:62044276-62044298 TAGTGGGAGGGGCTGGTGGATGG - Intronic
908322819 1:62994597-62994619 TTGGGGGATGGGACAGTGGATGG - Intergenic
910203491 1:84724259-84724281 CTGGGGTATGGGCTGGTAGATGG + Intergenic
910206267 1:84751729-84751751 CTGAGGGGTGGGAGGGTGGGAGG + Intergenic
910217192 1:84854335-84854357 CTGTGGGCTTGGATGGTCCATGG - Intronic
910246645 1:85145743-85145765 CTGAGGGATGGAATGGGAGAAGG + Intergenic
911138317 1:94467306-94467328 CTGTGGGATGGGAAGGTTTGGGG - Intronic
911588484 1:99718570-99718592 CTGTGGGAGGGTCTGGTGGGCGG - Intronic
911630525 1:100178832-100178854 CTGGAGGCAGGGATGGTGGAAGG - Intergenic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912727973 1:112076016-112076038 CGGAGGGATGGGTGGGTGGATGG + Intergenic
913176574 1:116278129-116278151 CTGAGGGATGTGATGATGGTGGG + Intergenic
913507012 1:119526474-119526496 CTGGGGGATGGGGTGGTTGTGGG - Intergenic
914712270 1:150225424-150225446 CTGTGGGATGCCAAGGTGGGCGG + Intronic
914807666 1:151003382-151003404 CTGTGGTTTGGGATTGTGTAAGG - Intronic
914824470 1:151131746-151131768 CTATGGGATGGGGCGGCGGAGGG - Exonic
915094188 1:153447829-153447851 CTTTGGGATGCCAAGGTGGAAGG - Intergenic
915930926 1:160060638-160060660 CTGGGGCCTGGGAGGGTGGATGG - Intronic
915945093 1:160143958-160143980 CTATCTGATGGGATGGGGGAAGG + Intergenic
916433616 1:164756122-164756144 CTTTGGGATGGCATGGAGAAGGG + Intronic
916821038 1:168399009-168399031 GAGTGGGATGGGAAGGTGGATGG + Intergenic
916912253 1:169363618-169363640 CTGGGTGGTGGGATGGTGCAGGG - Intronic
917930460 1:179819045-179819067 CTGTGTGCTGGGCTGGAGGATGG - Intergenic
918074383 1:181159344-181159366 CAGTGGGATGGGATGGGGCAGGG + Intergenic
918077064 1:181178482-181178504 CAGTGGGAGGGGGTGGTGAAGGG + Intergenic
918577432 1:186079717-186079739 CTATGGGATTGGATGGTCAAGGG + Intronic
919686295 1:200486733-200486755 CTGTGGGGAGGGCCGGTGGAGGG - Intergenic
919786596 1:201262109-201262131 CCGGGGGAAGGGGTGGTGGAGGG + Intergenic
919808150 1:201392970-201392992 CTGTTGGATTGGATGTTGGGTGG + Intronic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
920005226 1:202828409-202828431 CTTTGGGATGCCAAGGTGGAAGG + Intergenic
920005510 1:202830627-202830649 CTTTGGGATGCCAAGGTGGAAGG - Intergenic
920087042 1:203425029-203425051 GTGTGGGATGGGAGGGTGCCAGG + Intergenic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
922531551 1:226349085-226349107 CTGTGTGTTGGGGTGGTGGGGGG + Intergenic
923034665 1:230277265-230277287 CTGTCTGATGGGATTGTGGTTGG - Intronic
924172663 1:241357505-241357527 CTGTGCGATGGGTGGGTGGGTGG + Intergenic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924346806 1:243080091-243080113 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
1062805518 10:416824-416846 CTGTGGGCTTGGACGGTGCAGGG + Intronic
1063225344 10:4010494-4010516 CTTTGGGAGGGGGTGGTGGGAGG - Intergenic
1063345906 10:5312302-5312324 CTGTGTGATAACATGGTGGAGGG + Intergenic
1064104316 10:12488513-12488535 CCGTGGACTGGGATGGGGGATGG + Intronic
1064346594 10:14538057-14538079 CCATGGGCTGGGATGATGGATGG + Intronic
1065047460 10:21757252-21757274 CTGTAGGGTGGGATGGAGGTGGG - Intronic
1065129902 10:22610010-22610032 CTGTGGGATGAGGTTGTGGAGGG - Intronic
1065634409 10:27715850-27715872 CTATGGGATGGGCTGGGGGCTGG + Intronic
1065710577 10:28513213-28513235 CTGTGAGAAGATATGGTGGAAGG - Intergenic
1066265049 10:33768665-33768687 CTGTGGGAGGCCAAGGTGGACGG + Intergenic
1066457618 10:35585588-35585610 ATGTGGAATGGGATGCAGGAAGG - Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1066729541 10:38424771-38424793 CTTTGGGAGGGGGTGGTGGGGGG - Intergenic
1067142085 10:43666601-43666623 AGGAGGGATGGGATGGGGGATGG - Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067730983 10:48811434-48811456 CTATGGGATGGGTGGGTGGCCGG + Intronic
1068689943 10:59905484-59905506 CTTTGGGTTGGGAGGGTGGACGG - Intronic
1069281113 10:66654935-66654957 CTGTGGGATGGGGTGGAGTTGGG + Intronic
1069598580 10:69688495-69688517 CTGTGTCATGACATGGTGGAAGG - Intronic
1069705947 10:70459077-70459099 GGGTGGGGTGGGATGGGGGAAGG - Intergenic
1069920938 10:71815313-71815335 CCCTGGGAGGGGACGGTGGATGG - Exonic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1070182357 10:74026439-74026461 CTGTGGCATGGGATAGTAAATGG + Intronic
1070252828 10:74787923-74787945 CTTTGGGAAGCCATGGTGGAAGG + Intergenic
1070383459 10:75902385-75902407 GGGTGGGAGGGGATGGAGGAGGG + Intronic
1070744129 10:78922618-78922640 CTGTGGGGTGGGGTGCTGGCTGG - Intergenic
1070890401 10:79938739-79938761 CTGTGTGATGGGGTGATGAAAGG + Intronic
1070989381 10:80718236-80718258 CTGTGGGAGGCAATGGTGGGAGG - Intergenic
1072246436 10:93547821-93547843 CAGGTGGATGGGTTGGTGGATGG + Intergenic
1072752825 10:97995628-97995650 CTGTGGGGTGGGATGGTTCTTGG - Intronic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073121099 10:101123064-101123086 CAGTGGGGTGGGATGCTGGGGGG - Intronic
1073271128 10:102265029-102265051 CTGTGGCATGGGATGGGGCATGG + Intronic
1073423080 10:103440066-103440088 CTGTTGTTGGGGATGGTGGAGGG + Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074570470 10:114619591-114619613 CTGAGGGATGGGACGATGCATGG + Intronic
1074819710 10:117168774-117168796 GTGTGGGGTGGGATGGTGTCGGG - Intergenic
1075459193 10:122604781-122604803 ATGTGGGATTGCATGGTGGGGGG + Intronic
1075459825 10:122608840-122608862 ATGTGGGATTGCATGGTGGGGGG + Intronic
1075460457 10:122612899-122612921 ATGTGGGATTGCATGGTGGGGGG + Intronic
1075461089 10:122616958-122616980 ATGTGGGATTGCATGGTGGGGGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075686177 10:124366868-124366890 CTGGGAGCTGGGATGGTGGTGGG - Intergenic
1076112610 10:127872467-127872489 CTGTGGGATGGGATCAGGAATGG + Intergenic
1076212950 10:128664949-128664971 CTGGGGGATGGGAATGGGGAAGG + Intergenic
1076214103 10:128679124-128679146 ATCTGGGAGGGGATTGTGGAGGG + Intergenic
1076354425 10:129841665-129841687 CTGTGGGATGGGGTGCGGGGTGG + Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1076973396 11:151935-151957 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
1077176614 11:1193995-1194017 CTGTGAGATGAGACGGTGGGGGG + Intronic
1077194491 11:1272402-1272424 CTGGGGGATGAGATTGGGGAGGG - Intergenic
1077347503 11:2070666-2070688 TAGTGGGACAGGATGGTGGAGGG - Intergenic
1077472209 11:2769384-2769406 CTGTGAGTTGGGAGGATGGAGGG + Intronic
1077880577 11:6346492-6346514 CTGTGGGCGGGGTTGGGGGATGG - Intergenic
1078059756 11:8035579-8035601 CAGTGGGATGGAATGAAGGATGG - Intronic
1078102937 11:8340453-8340475 CTGTGTGATGCAATGGAGGAGGG - Intergenic
1078372924 11:10765703-10765725 CTTTGGGAGGCCATGGTGGATGG - Intronic
1078447686 11:11416885-11416907 CTGGGGGAGGGGATGGGGCAGGG - Intronic
1078532490 11:12147992-12148014 GTAAGGGATGGGGTGGTGGAGGG + Intronic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1079035434 11:17015529-17015551 CTGTAGGATGGGGTGGGGCACGG + Intergenic
1079044728 11:17091118-17091140 TTGGGGGATGGGATGGTGGGAGG + Intronic
1079260380 11:18872879-18872901 CTCTGCCATGCGATGGTGGAAGG + Intergenic
1079460817 11:20676347-20676369 CTGTGGGTTAGGTTGGGGGAGGG - Intronic
1079978035 11:27116915-27116937 CTGATAGATGGGATGTTGGATGG - Intronic
1080121605 11:28684435-28684457 CCAAGGGAGGGGATGGTGGAGGG + Intergenic
1080197016 11:29623327-29623349 GTGGGGGATGGGTTGGTAGAAGG - Intergenic
1080594480 11:33758230-33758252 GTCTGGTATGGGATGGGGGATGG - Intronic
1080793253 11:35539840-35539862 CTGTGGGAGGGGATCATGCAAGG - Intergenic
1081530200 11:43953269-43953291 CTTTGGGATGCCAAGGTGGATGG + Intergenic
1081663856 11:44904915-44904937 CTGAGGGCTGGGCTGATGGAAGG + Intronic
1081875762 11:46407476-46407498 CTCTGGGAGGAGGTGGTGGAAGG - Intronic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082882702 11:58053864-58053886 CTGGTGGTTGGGATGGGGGATGG - Intronic
1083290035 11:61684723-61684745 CTGTGGGAAGTGAGGGCGGAGGG + Intronic
1083302586 11:61746644-61746666 GTGTGGTATGGGGTGGAGGAGGG - Exonic
1083304679 11:61756182-61756204 CTGTGGGATGGGTAAGGGGAGGG + Intronic
1084178886 11:67437010-67437032 CTGAGGCCTGGGATGGGGGATGG + Intronic
1084182030 11:67451611-67451633 CTGTGGGATCCGATCGTGGCTGG + Exonic
1084406825 11:68979109-68979131 CTGTGGGAAGGAAAGGGGGAGGG + Intergenic
1084672322 11:70614667-70614689 CTGGAGGATGGGATGAAGGAAGG - Intronic
1084721448 11:70908338-70908360 CTGGGGGATGGGAGGATGCATGG - Intronic
1084970344 11:72768126-72768148 CTGTGGGCTGTGAGGGTAGAGGG - Intronic
1085013838 11:73159604-73159626 CTATGGGGTAGGAGGGTGGATGG - Intergenic
1085133596 11:74064041-74064063 TTGTGGGGTGGGACGGGGGAGGG - Intronic
1085652631 11:78282134-78282156 CTGTGGTATGGAATGGTATAAGG - Intronic
1085665426 11:78411158-78411180 TTGGGGGGGGGGATGGTGGAAGG + Intronic
1086499305 11:87435989-87436011 ATGTGGGAAGGAATGGTGTATGG + Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087775499 11:102253126-102253148 CTGTGTGATCTCATGGTGGAAGG + Intergenic
1088247131 11:107829472-107829494 CTGTGTCATAGCATGGTGGAAGG - Intronic
1089052187 11:115555525-115555547 CAGTGGGAGTGGATGATGGATGG + Intergenic
1089597906 11:119593499-119593521 CTGTGTCATAGCATGGTGGAGGG + Intergenic
1089689279 11:120176939-120176961 CTGTGGGAAGGGATGGGGCAGGG - Intronic
1089808899 11:121115253-121115275 TTGATGGATGGGTTGGTGGATGG - Intronic
1089809722 11:121121686-121121708 CTGAGGGTTGTGATGGTGGGGGG + Intronic
1090796786 11:130142109-130142131 CTGTGGGCTGGGTTGGGGGTGGG + Intronic
1091703042 12:2676615-2676637 CGGAGGGAGGGGCTGGTGGAAGG - Intronic
1091811583 12:3403310-3403332 CTATGGGAGGGGTTGGGGGAAGG + Intronic
1092165386 12:6339295-6339317 GTGTCAGATGGGATGGCGGAGGG - Intronic
1092394089 12:8109828-8109850 GTGTGTAATGGGATGGTGTAAGG + Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1095690594 12:45084255-45084277 CTGGGGGGTGGGGTGGTGGAGGG - Intergenic
1095804781 12:46307185-46307207 TTGTGGGATGGGGGGGTGGGGGG - Intergenic
1096048216 12:48583014-48583036 TTGTGGGGTGGGGTGGTGGGAGG - Intergenic
1096079598 12:48824815-48824837 GTGTGGGAAGGGTTTGTGGAGGG + Intronic
1096139147 12:49227784-49227806 CTGTGGACTAGGATGGCGGAGGG + Intronic
1096774256 12:53954767-53954789 GTGCGGGATGGGATGGTGGGGGG + Intergenic
1096826327 12:54280900-54280922 CTGTAGAATGGGCTGGTGCAAGG - Intronic
1096996395 12:55840816-55840838 GTGTGGGGTGGAAGGGTGGAGGG + Exonic
1097548904 12:61041656-61041678 CTGTGGAATGGAAAGGTAGAGGG - Intergenic
1097829973 12:64214045-64214067 GTGTGCAATGGGATGGTGAAGGG - Intronic
1097880430 12:64681518-64681540 ATGTGGGATGGGAAGTTGGCAGG - Intronic
1100293069 12:93235786-93235808 CAGTGGGAAGGGAAGCTGGAAGG - Intergenic
1100493783 12:95105778-95105800 CTTTGGGATGCGACGGTGGGTGG + Intronic
1100904279 12:99279563-99279585 CTGTGGGGTGGGGTGGGGGGAGG + Intronic
1101049299 12:100844589-100844611 CTGTGGGGTGGTAAGGTAGAGGG + Intronic
1101059371 12:100954989-100955011 CTGTGGGCAGTTATGGTGGAAGG - Intronic
1101168872 12:102067321-102067343 CTGAGAGATGGGATTGAGGAGGG - Intergenic
1101300415 12:103474053-103474075 CCATGGGATGGGGTGGTGGATGG - Intronic
1102451542 12:113045273-113045295 CTTTGGGATGGGATGGCGGGGGG + Intergenic
1102532689 12:113558416-113558438 CTGTGGGATGGGCTGGATAATGG + Intergenic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1103115953 12:118332066-118332088 CTGTGGGAGGCCAAGGTGGAAGG - Intronic
1103675848 12:122655114-122655136 ATGGGGGATGAGATGGTAGACGG - Intergenic
1103766505 12:123283967-123283989 CTGTGGGAGGGCAAGGTGGGTGG - Intergenic
1103889833 12:124230094-124230116 CTGTGGGCTGGTCTGCTGGAGGG + Intronic
1104567640 12:129899456-129899478 CTGGTGGATGGACTGGTGGATGG + Intronic
1104638668 12:130453402-130453424 CTGAGAGAGAGGATGGTGGAAGG - Intronic
1104712242 12:130995135-130995157 CTGTGGGAAGAGTTGGTGGTGGG + Intronic
1104874973 12:132027330-132027352 CTGTGGAGTGTGCTGGTGGAGGG + Intronic
1104896277 12:132166546-132166568 ATGAGGGATGGGTGGGTGGATGG - Intergenic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1105810802 13:23993598-23993620 CTGTGGGAAGGGCTGGGGCATGG - Intronic
1106873190 13:34043898-34043920 TTGGGGGATGGGGTGGTGGAGGG - Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108749280 13:53430743-53430765 CTTTGGGATGCCAAGGTGGATGG - Intergenic
1109241010 13:59888251-59888273 CTGTGTTCTGAGATGGTGGAGGG - Intronic
1111476614 13:88757856-88757878 CTGAGGGATGTCATGGGGGAAGG - Intergenic
1111912576 13:94328786-94328808 CTGTGGGAGGAGATGCTGGCTGG + Intronic
1112373280 13:98814693-98814715 CTTTGGGAAGGCATGGTGGGTGG + Intronic
1112573584 13:100615694-100615716 CTGTGGGATGCCAAGGTGGGCGG - Intronic
1112982554 13:105403756-105403778 CTGTGGGAAGGAAAGCTGGAAGG + Intergenic
1113536345 13:111069348-111069370 CTGTGGGAGGGGAGAGTGTAAGG + Intergenic
1113742949 13:112724030-112724052 GTGTGGGCAGGGATGATGGAGGG - Intronic
1113769449 13:112898914-112898936 TGGTGGGATGGGGTGGTGGTGGG - Intronic
1114277246 14:21157945-21157967 TGGTGGGATGGGATGGGGTAGGG + Intergenic
1114496269 14:23135008-23135030 CTTTGGGAAGGCAAGGTGGAAGG - Intronic
1114740117 14:25088234-25088256 CTGTGGGAGGCCAAGGTGGAAGG + Intergenic
1116217065 14:42030304-42030326 CTGTGTGATGGGCTTATGGAAGG - Intergenic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118430062 14:65708848-65708870 GTGTGGGAGGGGATGGGGAAAGG + Intronic
1118811963 14:69281723-69281745 CTGTGTGCTGGGATGGAGAAAGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119552521 14:75525294-75525316 ATGTGGGGTGGGTTAGTGGAGGG + Intronic
1119761722 14:77156506-77156528 CTGGGGGCTGGGGTGGTGGGCGG - Intronic
1120694884 14:87633457-87633479 AAGTGGAATGGGATGGTGGTGGG + Intergenic
1120849806 14:89159689-89159711 CTGTGGGGTGGGATGAAGGTGGG + Exonic
1120953777 14:90063911-90063933 ATCTGGGATGGGATGGGGGCTGG - Intronic
1121098708 14:91234988-91235010 CTGGTGGATGGTATGGTCGATGG + Exonic
1121273290 14:92651883-92651905 CTGGGGGAGGGGGTGGTGGGCGG - Exonic
1121291558 14:92779934-92779956 CTCTGTGTTGGGATGGTGGGTGG - Intergenic
1121341189 14:93106170-93106192 CTGTGGGGTGGTGGGGTGGATGG - Intronic
1121567759 14:94923508-94923530 CTGTGGGCAGTGAAGGTGGAGGG - Intergenic
1121734042 14:96205597-96205619 CAGGGGGATAGGATGGTGCAGGG + Intronic
1121794737 14:96725514-96725536 CTGTGGGCTGGGAAGGTGGGAGG - Intergenic
1122011505 14:98752934-98752956 CTTTTGGATGGGTGGGTGGATGG + Intergenic
1122289251 14:100671046-100671068 CTGTACGATGAGATGATGGATGG + Intergenic
1122442564 14:101742289-101742311 CTTTGGGAGGGCAAGGTGGATGG - Intergenic
1122468546 14:101950528-101950550 CTGAAGGATGGGATCCTGGATGG - Intergenic
1122600697 14:102920273-102920295 TAGTGGGAGTGGATGGTGGATGG - Intergenic
1123028119 14:105438193-105438215 CTGTGGGCAGGGCTGGTGGCTGG + Intronic
1123122296 14:105922268-105922290 CATTGGGAAGGGATGGAGGATGG + Exonic
1123917810 15:25050138-25050160 CTGCAGGATGGGATGGTGCCTGG + Intergenic
1124003157 15:25776320-25776342 CTGACGGATGGGGTGGGGGAGGG + Intronic
1125440435 15:39696920-39696942 GTGTGTGTTGGGATGGGGGAAGG + Intronic
1125537980 15:40453704-40453726 CTGTGGGAGGCCAAGGTGGAAGG + Intronic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1126776438 15:52104466-52104488 GTCTGGTATGGGATGGAGGAAGG - Intergenic
1127352024 15:58162622-58162644 CTGAGAGATGGCATGGTGCAGGG + Intronic
1128554696 15:68623490-68623512 CTTTGGGATGGGATGGGGTGGGG - Intronic
1128674016 15:69595674-69595696 CTGTGGGAGGGCATGGGGCAGGG + Intergenic
1129170701 15:73805836-73805858 CTGGTGGGTGGGAGGGTGGATGG - Intergenic
1129227233 15:74177076-74177098 CTGTGGGATGGTTTGGAGGAAGG - Intergenic
1129525054 15:76208531-76208553 CTGTGGGATGGGCTGGAGGAAGG - Intronic
1130017909 15:80201676-80201698 CTGTGGGATGGCAGGCTGGCAGG + Intergenic
1130109796 15:80954612-80954634 TTGGGGGAGGGGATGGAGGAAGG + Intronic
1130475357 15:84261436-84261458 CTGTGGGATGGGACTGTCCAAGG + Intergenic
1130482774 15:84375490-84375512 CTGTGGGATGGGACTGTCCAAGG + Intergenic
1130698100 15:86151150-86151172 TTGTGGGGTGGGGTGGGGGAGGG + Intronic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1132013964 15:98299931-98299953 CTGTGGGATGGGCTGGAGGTGGG - Intergenic
1132399087 15:101494409-101494431 CGGTGGGAGGGGCTGGTGGGAGG - Intronic
1132653875 16:1033604-1033626 CTGTTGGATGGATGGGTGGATGG - Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1133400173 16:5479954-5479976 CTGTGGGCTGGGCTGGAGGGTGG - Intergenic
1133478426 16:6146178-6146200 CTGTGGGAGGGGGTGGAGGCAGG + Intronic
1134031781 16:10998034-10998056 CAATGGGATGGGAGGGAGGATGG - Intronic
1134183619 16:12066366-12066388 CTCTGTGATGGGATGGAGGGTGG + Intronic
1134240576 16:12503098-12503120 CTGGGGGTGGGGGTGGTGGATGG - Intronic
1134752608 16:16638107-16638129 CTCTGGGATTGAATGGTGGAGGG + Intergenic
1134828662 16:17305655-17305677 CTTTGGGAGGCGGTGGTGGAGGG - Intronic
1134905102 16:17972994-17973016 CTTTGGGATGCCAAGGTGGAAGG + Intergenic
1134993453 16:18720969-18720991 CTCTGGGATTGAATGGTGGAGGG - Intergenic
1135257842 16:20955541-20955563 CTGTGGGATGGTGAGGTGGGAGG - Intronic
1135774170 16:25241805-25241827 CTGTGGCATGGGATGGGGAGAGG + Intronic
1135785449 16:25344933-25344955 CAGAGAGATGGGATGGAGGAGGG - Intergenic
1136269820 16:29141820-29141842 CTGTGGCATGGGGGGGTGGTGGG + Intergenic
1136350194 16:29701617-29701639 CTGTAGCATCGGATGGTGGGTGG - Intergenic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1137868835 16:51929873-51929895 CTTTGGGAAGGGAAGGTTGATGG - Intergenic
1138316409 16:56073763-56073785 CTCTGGGATGGGCTCTTGGAAGG + Intergenic
1138645704 16:58422954-58422976 GTGTGGGAGGCGATGGTGAAGGG - Intergenic
1138903388 16:61301444-61301466 CTTTGGAATGGGGTGGTGGGTGG + Intergenic
1138970391 16:62136018-62136040 AGGGGGGATGGGATGGGGGAGGG - Intergenic
1139398347 16:66659005-66659027 CTGTGGGATGGGGTTGGGGGTGG - Intronic
1139446689 16:67002576-67002598 CTGGGGGATGGTATGGGGTAAGG + Intronic
1139666506 16:68460627-68460649 CAGTGGAATGGGCTGATGGAAGG - Intergenic
1140240955 16:73199727-73199749 CTTTGGGAGGCCATGGTGGATGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140486016 16:75294095-75294117 CTGGGGGATGGGACTGTGCAGGG - Intronic
1140586967 16:76304429-76304451 CGGTAGGATGGGAGGGTTGAGGG + Intronic
1141314319 16:82946260-82946282 ATGTGGGAGGGAAGGGTGGAAGG + Intronic
1141606921 16:85159063-85159085 CAGTGGGATGGGGTGGGGGCAGG - Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1142228358 16:88888317-88888339 CTGTGGCCTGGGCTGGGGGAGGG - Intronic
1142363281 16:89637165-89637187 CTGGGGGCTGTGAGGGTGGACGG + Intronic
1142446854 16:90145595-90145617 CTTTGGGAGGGGGTGGTGGGGGG - Intergenic
1142460635 17:89730-89752 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
1142613843 17:1123981-1124003 CTGTGGGAAGGGCTGGCGGGGGG - Intronic
1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG + Intronic
1142867305 17:2798650-2798672 GGGTGGGATGGGATGGGAGAGGG + Intronic
1142983210 17:3683218-3683240 AGGTGGGAAGGGTTGGTGGAGGG + Intronic
1143176844 17:4960317-4960339 GTCTGGGATGGGATGGCAGAGGG + Exonic
1143473428 17:7190370-7190392 GTGTGGGAGAGGATGGGGGAGGG + Exonic
1143832001 17:9659999-9660021 CTTTGGGATGGGAATGGGGATGG + Intronic
1143854509 17:9838830-9838852 CTGTGAGATGGGAGAGAGGAAGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144125842 17:12202333-12202355 CTGTGGCATGTGATGGTGGAGGG + Intergenic
1144346361 17:14353408-14353430 CCATGGGATGGGGTGGTAGAGGG + Intergenic
1144754275 17:17669810-17669832 CTGTGGGATGGGGGTGGGGAGGG - Intergenic
1144763551 17:17720987-17721009 TAGAGGGATGGGATGGTGGTGGG - Intronic
1144845430 17:18215750-18215772 CTTTGGGAAGCTATGGTGGATGG + Intergenic
1145018114 17:19411947-19411969 CTGTAGCATGGGGTTGTGGAGGG + Intronic
1145040986 17:19578437-19578459 CTTTGGGAGGGCAAGGTGGAAGG - Exonic
1145725642 17:27120541-27120563 CTTTGGGAGGCCATGGTGGATGG + Intergenic
1145890968 17:28415448-28415470 CTGTGTGATGTCCTGGTGGAGGG + Intergenic
1146018020 17:29249212-29249234 CTGTTGGATGTGATGGGGGTGGG - Intronic
1146095982 17:29930409-29930431 CTGTGGAGTGGGGTGGGGGAAGG + Intronic
1146162423 17:30567086-30567108 CAGAGGGATGGGATGGAGGGAGG - Intergenic
1146286566 17:31578061-31578083 CCATGGGAGGGGATGGTTGAGGG - Intergenic
1146548639 17:33761401-33761423 CACAGGGATGGGATGGGGGAAGG + Intronic
1147159181 17:38560687-38560709 CTGTGGAATGGTTTGGGGGAGGG - Intronic
1147426986 17:40350641-40350663 TTGGGGGATGGGATGGGGGAGGG + Intronic
1147534081 17:41307189-41307211 CAGAGGGATGGGTGGGTGGATGG + Intergenic
1148216535 17:45836596-45836618 CTGTTGGGTGGGATGAGGGAGGG - Intergenic
1148460954 17:47838720-47838742 CTGTGGGAGGGGAGAGTGGCTGG + Intronic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1149626629 17:58084256-58084278 CTGGAGGATGGGATAGTGGAGGG + Intronic
1149697676 17:58629215-58629237 CTGTGGGAGGCCAAGGTGGATGG + Intronic
1150017580 17:61573772-61573794 CTATTGGAAGGGATGGAGGAAGG - Intergenic
1150222743 17:63506496-63506518 CAGGTGGATGGGATGATGGATGG - Intronic
1150299789 17:64038481-64038503 GAGTAGGATGGGATGGTGGCAGG + Intergenic
1151166169 17:72205654-72205676 CCGTGGGAGGGGGTGGTGGTGGG - Intergenic
1151379752 17:73717570-73717592 CTGTGGGATCGGTGGGGGGAGGG - Intergenic
1151569358 17:74918341-74918363 CTGTGGGATGCCATTGGGGAGGG + Intronic
1151620299 17:75240914-75240936 CTGAGGCCTGGGGTGGTGGAGGG + Exonic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152102671 17:78311784-78311806 TTGTGGGATTGGAAAGTGGAAGG - Intergenic
1152123820 17:78434629-78434651 ATGGGGGATGGGATAGAGGATGG + Intronic
1152123827 17:78434648-78434670 ATGGGGGATGGGATAGAGGATGG + Intronic
1152431275 17:80249370-80249392 CTCTGGGCTGTGATGCTGGACGG + Intronic
1152446206 17:80345839-80345861 CTGTGTGATCATATGGTGGATGG + Exonic
1153051368 18:905767-905789 CTGTGGGCCGGGTTGGGGGAGGG - Intronic
1154393824 18:13968960-13968982 CTGTGGCATCACATGGTGGAAGG + Intergenic
1155130233 18:22927322-22927344 GTGGGGGATGGGATGATGCAGGG + Intronic
1156310016 18:35913227-35913249 GTGTGTGGTGGGATGGGGGAGGG - Intergenic
1156377468 18:36527871-36527893 CAGTGAGCTGAGATGGTGGAGGG - Intronic
1156762893 18:40614676-40614698 ATGTCTGATGGGATGATGGATGG + Intergenic
1157287437 18:46386590-46386612 CTGCCGGATGGAATGATGGATGG - Intronic
1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG + Intronic
1157386063 18:47260839-47260861 AGGTGGGATGGGGTGGGGGATGG + Intergenic
1157537907 18:48474077-48474099 CAGTGGGCTGGGATGGGGGGTGG + Intergenic
1158588114 18:58758273-58758295 GTGTGGCATGGGCTGCTGGACGG - Intergenic
1159050805 18:63419528-63419550 CTGTGGGATGGGAGGCGGTAAGG - Intronic
1159104818 18:63994045-63994067 AGGAGGGATGGGATGGGGGAAGG - Intronic
1159775882 18:72602266-72602288 ATAAGGGAGGGGATGGTGGACGG + Intronic
1159928239 18:74288254-74288276 GTGTGTGGTGAGATGGTGGAGGG - Intronic
1160461642 18:79043411-79043433 GTGGGGGTTGGGATGGGGGATGG - Intergenic
1160461667 18:79043459-79043481 GTGAGGGTTGGGATGGGGGATGG - Intergenic
1160650352 19:222236-222258 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
1161151630 19:2713150-2713172 GTGAGGGATGGGATGAAGGATGG - Intergenic
1161609249 19:5231786-5231808 AGGTGGGATGGGCGGGTGGATGG + Intronic
1162311637 19:9911357-9911379 CTGAGGGATGGGGTGGTGTCAGG + Intronic
1162454545 19:10775519-10775541 CTGTAGGATGGGATCCTAGAAGG + Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163112199 19:15168283-15168305 CTTTGGGATGGGAAGGCAGAAGG + Intronic
1163273289 19:16266971-16266993 CTGGAGGAAGGGATGCTGGAAGG + Intergenic
1163741250 19:19014390-19014412 TTGTGGGGTGTGAGGGTGGAAGG + Intronic
1163741706 19:19018102-19018124 TTGTGGGGTGTGAGGGTGGAAGG - Intronic
1163991666 19:21004270-21004292 CTTTAGGATGGGATGATAGAAGG + Intergenic
1164765443 19:30762335-30762357 TTGTGGGGTGAGATGGTGAAAGG - Intergenic
1165301545 19:34972867-34972889 CTCAGGGGTGGGATGGTGGTGGG - Intergenic
1166975279 19:46601911-46601933 CTCCTGGATGGGGTGGTGGAGGG + Intronic
1167225383 19:48235625-48235647 CTTTGGGATGCCAAGGTGGAAGG - Intronic
1167261770 19:48462806-48462828 CTTTGCGAGGGGGTGGTGGAGGG + Intronic
1167369275 19:49071245-49071267 CTCTGGGCTGGGACTGTGGAGGG - Intronic
1167612792 19:50515345-50515367 CTGTTGGGTGGGTTGGGGGAGGG - Intergenic
1167635150 19:50649922-50649944 CTGTGGGAGGGAATTGTGGGAGG - Intronic
1168095157 19:54110245-54110267 CGGAGGGATGGGAAGGTGGAAGG - Intronic
1168282358 19:55312318-55312340 CTGCGGGGTGGGGTGGGGGAGGG + Exonic
1168447230 19:56430466-56430488 CTGATTGATTGGATGGTGGAAGG + Intronic
925260198 2:2522054-2522076 ATGGGGGATGGGCAGGTGGATGG - Intergenic
925411039 2:3640460-3640482 CTGTGGGATGTGACGGGGGTGGG - Intronic
925411086 2:3640607-3640629 CTGTGGGATGCGACGGGGGTGGG - Intronic
925411095 2:3640636-3640658 CTGTGGGATGTGACGGGGGTGGG - Intronic
925411142 2:3640783-3640805 CTGTGGGATGTGACGGGGGTGGG - Intronic
925546400 2:5021620-5021642 CACTGGGATGTGATGGAGGAAGG + Intergenic
926285706 2:11486003-11486025 CTGTGGGATGGGCTGGTGACAGG + Intergenic
927102478 2:19798785-19798807 CAGTGGGATGGGGTGGGGCAGGG - Intergenic
927521438 2:23701115-23701137 TGGTGGGATGGGAAGGTTGAGGG - Intronic
928015843 2:27656363-27656385 CTGGAGGATGGGTTGGTGGGGGG - Intronic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
929216924 2:39424345-39424367 AGGTGGGAGGGGATGGAGGAAGG + Intronic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
930002951 2:46873588-46873610 CTGTGCAATGGGGTGGTGGTGGG - Intergenic
930066576 2:47332436-47332458 CTGTGGGAAGGGAAGATTGACGG - Intergenic
930084025 2:47480134-47480156 ATGGGGGATGGGAAGGGGGAGGG - Intronic
930105746 2:47638012-47638034 CTGTTGGATGGGAGGATGGCAGG - Intergenic
930198180 2:48529734-48529756 CTCTGGGTGGGGATGATGGAGGG - Intronic
930217894 2:48715710-48715732 CTGTGTTGTGGGTTGGTGGAAGG - Intronic
930430847 2:51274104-51274126 CTATGGGATGGGAAGGTGTAAGG + Intergenic
931718824 2:65052308-65052330 CTGTTGGATGGAATTGTGGTTGG + Intergenic
931903530 2:66818787-66818809 CTCTTGGATGTGCTGGTGGAAGG + Intergenic
932306208 2:70705697-70705719 CTGTGGGATGGGGTGTGGGAAGG - Intronic
932419857 2:71595344-71595366 CTATGAGGTGGCATGGTGGAAGG + Intronic
932894939 2:75630541-75630563 CTTTGGGAGGCCATGGTGGATGG + Intergenic
934069101 2:88367241-88367263 GTGTGGGATGGGGTGGTGCTTGG + Intergenic
934777338 2:96947835-96947857 CTGTGGGATCTCATTGTGGATGG - Exonic
935710008 2:105889827-105889849 CTTTGGGATGCCATGGTGGCAGG - Intronic
935831460 2:107004999-107005021 CTGAGGGAGGGGATGAGGGAGGG + Intergenic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
936167721 2:110138171-110138193 TTGTGGGGTGGGGTGGGGGAGGG + Intronic
937237885 2:120441799-120441821 CTTTGGTATGGGGTGTTGGAGGG - Intergenic
937890611 2:126935698-126935720 CTGTGGGTTGGGGTGCTGGGTGG - Intergenic
938973893 2:136457465-136457487 CTCTGGGTTGGGCTGGTGGCTGG + Intergenic
940451355 2:153842119-153842141 CTGTGGGATGGGGAGGTGGGGGG + Intergenic
940484230 2:154276477-154276499 CTTTGGGAGGCAATGGTGGATGG - Intronic
940718359 2:157254692-157254714 ATTTGGGGTGGGATGGTGGCTGG + Intergenic
941080880 2:161059275-161059297 CTGGAGGTTGGGATGGTAGATGG - Intergenic
941767599 2:169315371-169315393 CTCTGGGATGGGAGCATGGATGG + Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942277517 2:174334010-174334032 CTGTGGGCTGGCATGGGGGTGGG - Intergenic
942505199 2:176634550-176634572 CTGGGGGTGGGGATGGTTGAAGG + Intergenic
942543038 2:177034670-177034692 TTGTGGGATGGGGGGGGGGAGGG - Intergenic
942545417 2:177058264-177058286 CTTTGGGGTGGGAGGGTGGCGGG + Intergenic
942638038 2:178029937-178029959 CTGTGGCATAACATGGTGGAAGG - Intronic
942747949 2:179257035-179257057 CTGTGGCATGAGATGCTGGGTGG - Intronic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
946009666 2:216554614-216554636 CTAGGAGATGGGCTGGTGGAGGG + Intronic
946246964 2:218393309-218393331 CTGGGGGGTGGGAGGGGGGAAGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
947136943 2:226984917-226984939 CTGGGGGTTGGGGTGGGGGAGGG + Intronic
947231533 2:227892623-227892645 CTGTGGGAGAAGATGGTAGAAGG + Intronic
947637384 2:231686926-231686948 CTGTGGGATGTGATGGAGCCAGG - Intergenic
947952184 2:234158014-234158036 CTTAGGGAGGGGATGGGGGAGGG - Intergenic
948619952 2:239228032-239228054 CAAAGGGATGGGAAGGTGGAAGG + Intronic
948722725 2:239911738-239911760 CTGGGGGATGGGCTGGGGGAAGG - Intronic
948980635 2:241492647-241492669 CTGTTGGATGGGTTTGTGGATGG + Intronic
949008092 2:241661737-241661759 GGGGGGGATGGGTTGGTGGATGG - Intronic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1169356696 20:4912827-4912849 TTGTGGGAGGGGATGGCGGTGGG + Intronic
1169417678 20:5431873-5431895 CTGAGGCATGGGACAGTGGAGGG - Intergenic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1169734991 20:8828147-8828169 TTGGGGGGTGTGATGGTGGATGG + Intronic
1170087262 20:12547931-12547953 CAGTGGGATGGCTTGGTGGTAGG + Intergenic
1170176088 20:13471645-13471667 ATGTGGGATGGATTGGAGGAAGG - Intronic
1170792064 20:19516603-19516625 ATGTGGGGTGGGATGGCTGAAGG + Intronic
1170899994 20:20453335-20453357 CTATGGCATGAGATGGGGGAAGG + Intronic
1171498562 20:25575507-25575529 CTTTGGGAGGGCAAGGTGGATGG + Intronic
1171839960 20:30197452-30197474 CTGTGGGATAGAGAGGTGGAAGG - Intergenic
1172187191 20:33038351-33038373 CTGATGGATGGGAGGATGGATGG - Intronic
1172301380 20:33852875-33852897 TTGTGCGAGGGGATGGGGGAAGG - Intronic
1172535284 20:35667984-35668006 CTTTGGGAGGCGAAGGTGGATGG - Intronic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1172977265 20:38915731-38915753 CTTTGGGAGGCTATGGTGGATGG - Intronic
1173324265 20:42018403-42018425 CTGTGGGCTGGGTTGATGGATGG + Intergenic
1173356095 20:42292106-42292128 AGGTGGGGTGGGATGGTGGGAGG - Intronic
1173400825 20:42724472-42724494 TTGGGGTAGGGGATGGTGGAGGG - Intronic
1173515436 20:43662419-43662441 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
1173576934 20:44118347-44118369 ATGTGGGATGGGATGATGCAGGG - Intronic
1174008328 20:47428266-47428288 CAGAGGGAAGGGAAGGTGGACGG - Intergenic
1174033429 20:47650033-47650055 CAGTGTGTTGGGGTGGTGGAGGG - Intronic
1174041898 20:47706141-47706163 CTGAGGGGTGAGATGCTGGAGGG - Intronic
1174054427 20:47788223-47788245 CTGGGGCCTGGGGTGGTGGAGGG + Intergenic
1174088764 20:48029979-48030001 GTGTGGGGTGGGATGGGGAAAGG - Intergenic
1174127243 20:48315611-48315633 GTGTGGGGTGGGGAGGTGGAGGG + Intergenic
1174196558 20:48776430-48776452 CTGTGGGAGGGGATGGCAGCTGG + Intronic
1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG + Intergenic
1174506019 20:51018137-51018159 CTGTGGGGTGGGATTTGGGAGGG + Intronic
1175186407 20:57182050-57182072 CGGCGGGATGGGATTGGGGATGG + Intronic
1175291955 20:57881897-57881919 CTGTGGGGAGGGATAGCGGAGGG - Intergenic
1175740185 20:61414621-61414643 CCGTGTGATGGGGTGGTGGAGGG + Intronic
1175991221 20:62790478-62790500 CTGTGGGATGGGACAGTAGGAGG - Intergenic
1176076546 20:63250936-63250958 CTTTTGGCTGGGATGGGGGATGG - Intronic
1176132893 20:63503729-63503751 CTGTGGGAGGCGATGGTGGGCGG - Intergenic
1178053264 21:28770702-28770724 CTGTGTGATCTCATGGTGGAAGG - Intergenic
1179644068 21:42764968-42764990 TTGTGGGGTGGGTGGGTGGATGG + Intronic
1179880853 21:44292843-44292865 CGGAGGGCTGGCATGGTGGAAGG - Intronic
1180042311 21:45287157-45287179 CTGGGGGATGGGATGGGGCGGGG - Intronic
1180042359 21:45287261-45287283 CCGAGGGATGGGATGGGGGCGGG - Intronic
1180042375 21:45287293-45287315 GGGTGGGATGGGATGGGGGCAGG - Intronic
1180042412 21:45287372-45287394 CGATGGGATGGGATGGGGGCGGG - Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1181387817 22:22558141-22558163 CAGTGGGGGGGGATGGAGGAAGG + Intronic
1181528306 22:23502358-23502380 GTGGGGGATGGGAGGATGGAGGG - Intergenic
1182039998 22:27230562-27230584 CTGTTGGCTGGGATGCTGGGAGG + Intergenic
1182093695 22:27612510-27612532 CTGGGGGATGGGGTGGTTGTGGG - Intergenic
1182112158 22:27731499-27731521 CATGGGGATGGGATGGTGAAGGG - Intergenic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182758241 22:32698873-32698895 CAGTGGCATGAGATGGAGGAGGG + Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183132601 22:35853735-35853757 CGGTGGAATGGGGTGGTGGCTGG + Intronic
1183330255 22:37216190-37216212 CTGTGGGATGGGGGGGTGGGAGG - Intergenic
1183340782 22:37280026-37280048 CTGTGAGATGGGATGCTGCCAGG + Intergenic
1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG + Intronic
1183662437 22:39229595-39229617 TGTGGGGATGGGATGGTGGAAGG - Intronic
1183804956 22:40200876-40200898 CAGTGGAATGTGATGGTGGTGGG + Intronic
1184539384 22:45110043-45110065 AAATGGGATGGGATGGAGGAAGG + Intergenic
1184651328 22:45920634-45920656 ATGGGGGATGGGATGGGGGGTGG + Exonic
1184651343 22:45920672-45920694 ATGAGGGATGGGATGGGGGATGG + Exonic
1184651354 22:45920696-45920718 GTCAGGGATGGGATGGGGGATGG + Exonic
1184681511 22:46074715-46074737 CTATGGTGTGGGCTGGTGGAAGG + Intronic
1184685948 22:46096419-46096441 CTGTGGGATGGGAAGAGGGTCGG + Intronic
1184744680 22:46449408-46449430 CTGTGTGATGGGTGGTTGGATGG - Intronic
1184963668 22:47950672-47950694 CTGTGGGATCCCATGCTGGAGGG - Intergenic
1185329874 22:50247696-50247718 CTCTTAGATGGGATGCTGGATGG - Exonic
1185380361 22:50505016-50505038 CTGGGGGATGGGCTGGGGGCAGG - Intronic
949927982 3:9057252-9057274 CTGTGGGCTGGGCTGCTGGCAGG + Intronic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
952835463 3:37598356-37598378 CTGGGGGAGGGGATGGTGCCAGG + Intronic
953215865 3:40917507-40917529 CTGGGGGACAGGATGGTGAACGG - Intergenic
953585827 3:44200194-44200216 GTGTGGGATGGGGGGGTGGGGGG - Intergenic
953890681 3:46749959-46749981 CTATGAGAGAGGATGGTGGAGGG + Intronic
954036878 3:47855592-47855614 CTGTGGCATGGGGTGGTGGAAGG - Intronic
954207882 3:49074023-49074045 CTTTGGGATGCCAAGGTGGACGG - Intronic
954334768 3:49909772-49909794 CTGGGGGAGGGGGTGGAGGAGGG + Intronic
954364123 3:50137345-50137367 CAGTGGGGTGGGATTGGGGAAGG + Intergenic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
954704032 3:52469263-52469285 CTGTGGGATGTGGGGGTGGGGGG + Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
954902544 3:54032129-54032151 CTGGGGCAAGGGATGATGGATGG + Intergenic
955063718 3:55516535-55516557 CTGGGGGCTGGGATGGGGGTGGG + Intronic
955406759 3:58630610-58630632 CTGTGGGAAGGAGTGGAGGAAGG - Intergenic
955633234 3:60997487-60997509 CTGTGGGGTGGGAGTGTTGAGGG + Intronic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956383013 3:68686049-68686071 CTGGGGGAAAGGATGGTGGTGGG - Intergenic
956857334 3:73288010-73288032 GTGTGGGGTGGGATGGTTAAAGG + Intergenic
956917807 3:73891507-73891529 CTGAGGGTTGGGGTGGTGGGAGG + Intergenic
957257759 3:77860471-77860493 TTGTGGGGTGGGGTGGGGGAGGG + Intergenic
958473778 3:94554435-94554457 TTGTGTGGTGGGGTGGTGGAGGG + Intergenic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
959574428 3:107919230-107919252 GGATGGCATGGGATGGTGGAAGG - Intergenic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
960450305 3:117798721-117798743 CTGGTGGGTGGGATGGTGGTAGG + Intergenic
960798530 3:121514083-121514105 CTGTGGGAGGCCAAGGTGGACGG + Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961818471 3:129563321-129563343 CTGTTGGAGGGGTTGGGGGACGG - Intronic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
962125568 3:132613653-132613675 CTTTGGGATGCCAAGGTGGATGG + Intronic
962606231 3:137035054-137035076 TGGAGGGATGGGAGGGTGGAGGG + Intergenic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963868849 3:150391916-150391938 GTGTGGGATGGGGTGGGAGAGGG - Intergenic
964271358 3:154959704-154959726 CTATGGGATGGGATGGGAGAAGG + Intergenic
964542646 3:157796718-157796740 CTGTGGGTGAGTATGGTGGAAGG - Intergenic
964846473 3:161049616-161049638 CTGTAGAATGGGATAGGGGATGG + Intronic
965523837 3:169696247-169696269 CTGTGGGAGGGGATTATGAATGG - Intergenic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
966393205 3:179474858-179474880 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
966868867 3:184277241-184277263 CTGTGGGATGGGTCTGTGGTAGG - Exonic
966914726 3:184578391-184578413 CTGTAGGGTGGCAGGGTGGAGGG - Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967332570 3:188306330-188306352 CTTTGGGAGGGCATGGTGGGTGG - Intronic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
968086940 3:195878038-195878060 CAGTGGGAAAGGGTGGTGGAGGG + Intronic
968367494 3:198197893-198197915 CTTTGGGAGGGGGTGGTGGGGGG - Intergenic
969333801 4:6495054-6495076 CTGTGGGATGGGGTGTTGGCAGG - Intronic
969441557 4:7220137-7220159 CTGTGTGCTGGGCTGGTGGCAGG + Intronic
969704628 4:8785033-8785055 TTGTGGGAAGGGTGGGTGGAGGG - Intergenic
969719964 4:8888205-8888227 CTGTGGGGTGCGGAGGTGGAGGG - Intergenic
969902758 4:10364798-10364820 TTGTGGGATGAGCTGGTTGAAGG + Intergenic
970050124 4:11904999-11905021 CTGTGGGAAGGGAGGATGAAGGG + Intergenic
970629825 4:17928161-17928183 CTTTGGGATGGTAAGGTGGGTGG + Intronic
970720378 4:18981215-18981237 GTGTGGCAAGGGATAGTGGATGG + Intergenic
971448238 4:26775590-26775612 CTGTGTCATCTGATGGTGGAAGG - Intergenic
971709873 4:30097290-30097312 GTGGGGGATGGGGTGGGGGAAGG - Intergenic
972487075 4:39552300-39552322 ATTTGGGATGGGATGGTTGGGGG - Intronic
973545241 4:51974293-51974315 CTGGGGAATGGGATGGTTGTAGG - Intergenic
974401708 4:61416766-61416788 GGGTGGGATGAGGTGGTGGATGG + Intronic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
975718362 4:77227284-77227306 CTGTGGGAGGGGATAGGGGGTGG + Intronic
976269071 4:83212435-83212457 GTGTGGGTGGGGGTGGTGGAGGG + Intergenic
976388388 4:84484540-84484562 CTGGGGGAGGGGGTGGGGGAAGG - Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979962108 4:127033586-127033608 TTATTGGATGGGATGTTGGATGG - Intergenic
979994901 4:127420121-127420143 CTGTCTGATGGGGTGGTAGAGGG - Intergenic
981092687 4:140747802-140747824 CTTTGGGTTGGGACGATGGAGGG + Intronic
981751436 4:148095786-148095808 GGCTGGGATGGGAGGGTGGAGGG + Intronic
982753553 4:159191495-159191517 CTGTGGGAGGCCAAGGTGGACGG + Intronic
985159631 4:187031132-187031154 TTGTGGGATGGGAGGGAGGGGGG - Intergenic
985397351 4:189558016-189558038 ATTTGGGTGGGGATGGTGGAAGG - Intergenic
985674464 5:1223846-1223868 CTGCTGGATGGGGTGCTGGAAGG - Exonic
985805384 5:2039265-2039287 CTGTGGGAAGGGACTGGGGAAGG - Intergenic
986953654 5:13123295-13123317 TTGTGGGATGGGTTGGAGGAAGG + Intergenic
988033767 5:25798690-25798712 ATGTTGGATGGGCTGGTGGGTGG - Intergenic
988047287 5:25972842-25972864 CTTTGGGATGCCATGGTGGGTGG + Intergenic
988062488 5:26190398-26190420 TTGGGGGATTGGAGGGTGGAGGG + Intergenic
988556689 5:32242674-32242696 GTGTGGGAAGGGAAGGTGGCTGG - Intronic
988675361 5:33427854-33427876 CTATGGGAGGGGAGGATGGATGG + Intergenic
988713980 5:33806415-33806437 CTGTGGAATGGAATGGTGTTGGG + Intronic
989192111 5:38680694-38680716 CTTTGGGGTGGGATGGGGGATGG - Intergenic
989372475 5:40723619-40723641 CTGTGGGAGGCCATGGTGGGCGG + Intronic
990236427 5:53772830-53772852 ATGTGGGATGGGCGGGAGGAGGG + Intergenic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
991295404 5:65074961-65074983 ATGTGGGCTGGGATGGCTGAGGG + Intergenic
991425576 5:66488631-66488653 CTTTGGGAGGCCATGGTGGAAGG + Intergenic
991613966 5:68476938-68476960 TTCTGGGGTGGGGTGGTGGAGGG - Intergenic
992484458 5:77181190-77181212 CTGTGGGAAGGGATGTTTGGAGG + Intergenic
993944165 5:94097840-94097862 CGGTGGGGTGGGGTGGTGGGGGG - Intronic
995506980 5:112870793-112870815 CTGTGTGATCCCATGGTGGAAGG - Intronic
995723608 5:115163482-115163504 CTGTGGGCTGGGATGGTAGTGGG - Intronic
996059525 5:119017753-119017775 CTTTGGGAGGTGATGGAGGAGGG + Intergenic
996396056 5:123015201-123015223 CTGTTGAATGGGTGGGTGGATGG + Intronic
996957156 5:129197233-129197255 CAGTGGGCAGGGAAGGTGGAGGG - Intergenic
997005786 5:129814817-129814839 CTGTGGGAGGGCATGGAGGGAGG - Intergenic
997298321 5:132783762-132783784 CTTTGGGATGCCATGGTGGGAGG + Intronic
997387960 5:133488743-133488765 CTGTGGGATGGGAGTGGGTATGG + Intronic
997703568 5:135925256-135925278 GGGTGGGATGGGAGGGTGGAGGG - Intronic
997747862 5:136315406-136315428 AGGTGGGAAGGGATGGTGGAGGG + Intronic
997866169 5:137464728-137464750 CTGTGGGGTGACAAGGTGGAGGG + Intronic
997879286 5:137574954-137574976 ATGTGTGGTGGGATGGTAGAGGG - Intronic
999396217 5:151230247-151230269 CAGTGGGATGGGATGGGGTGAGG - Intronic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001396400 5:171421731-171421753 CTTGGGGATGGAAGGGTGGACGG + Intronic
1001415528 5:171542678-171542700 CCCTGGCATGGGCTGGTGGAAGG + Intergenic
1001513801 5:172341029-172341051 CTGTTGGCTGGAATGGTGGGTGG + Intronic
1001528792 5:172447879-172447901 CTATGGGGTGGGGTGGGGGATGG + Intronic
1001632922 5:173189925-173189947 CCGAGGGATGGGGTGGTTGAGGG - Intergenic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001686355 5:173597595-173597617 GGATGGGATGGGATGATGGAGGG - Intergenic
1002056574 5:176601227-176601249 CTCTGGGATGGTATGGAGGCTGG + Intronic
1002077823 5:176719638-176719660 CTGAGGGAAGGGATGGTGGTGGG - Intergenic
1002330024 5:178434748-178434770 CTGAGGCCTGGGATGGTGGAGGG + Intronic
1002414412 5:179111975-179111997 GTGTGGGATGCGGTGGTGGAGGG + Exonic
1002435095 5:179226518-179226540 CTGTGGGAGGCCAGGGTGGATGG - Intronic
1002466625 5:179411931-179411953 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466717 5:179412141-179412163 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466977 5:179412739-179412761 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1002726718 5:181303120-181303142 CTTTGGGAGGGGGTGGTGGGGGG - Intergenic
1004136898 6:12976105-12976127 CTGGGGGAGGGGGTGATGGAAGG + Intronic
1004143831 6:13046436-13046458 CTAAGGGATGGGGTGGAGGAGGG + Intronic
1004222277 6:13757057-13757079 CTTTGGGAGGCGAAGGTGGATGG + Intergenic
1004263472 6:14129071-14129093 CTGAGGGAGGGGTTGCTGGATGG + Intronic
1004947997 6:20636670-20636692 CTGAGAGGTGGGATGGGGGAGGG + Intronic
1005285353 6:24320573-24320595 CTTTGGGATGCCAAGGTGGACGG - Intronic
1005492782 6:26361920-26361942 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005496947 6:26396041-26396063 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1006065362 6:31457566-31457588 CTGGGGCATGGAATGATGGATGG - Intergenic
1006368628 6:33631063-33631085 CACTGGGATGGGCTGGTGGTGGG - Intronic
1007067607 6:39007785-39007807 CAGTGGGGTGGGGTGGTGGGAGG - Intronic
1007133166 6:39495831-39495853 ATGGGGGAGGGGATGGAGGAGGG + Intronic
1007373955 6:41443757-41443779 GTGTGCGAGGGGATGGGGGAAGG + Intergenic
1007553363 6:42746656-42746678 TTGGGGGAAGGGGTGGTGGAAGG - Intergenic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008147764 6:47912266-47912288 GTGGGGGATGGGATGGGGGTGGG - Intronic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1008877806 6:56348550-56348572 CTGTAGCATGGGAAGGTGGCTGG + Intronic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1010393472 6:75363187-75363209 ATTTGGGATGGGGTGGGGGAGGG + Intronic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1011657266 6:89563292-89563314 CAGTGGGCTGGGAGGATGGAGGG + Intronic
1012094006 6:94934660-94934682 CTGAGGGAAGTCATGGTGGAGGG - Intergenic
1012950164 6:105509742-105509764 GTGTGGGGTGGGGAGGTGGAAGG + Intergenic
1013088934 6:106881893-106881915 CTTTGGGATGCCAAGGTGGACGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013428516 6:110035758-110035780 CTGTGGGAGGTCAAGGTGGAAGG + Intergenic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1013946603 6:115729202-115729224 CTGGGGGATGGCATGGGGGTTGG - Intergenic
1014735000 6:125083036-125083058 CTGGGAGATGAGATGGTAGAAGG - Exonic
1015037208 6:128670132-128670154 CTGAGGGTGGTGATGGTGGATGG + Intergenic
1015438238 6:133215970-133215992 CTGTGGGTTGGGAAGATGGGAGG - Intergenic
1015525221 6:134169310-134169332 TTGTGTGATGGGATGAGGGAAGG + Exonic
1016068452 6:139708336-139708358 TTTTGGAATGGGATGGTGGTAGG + Intergenic
1016075327 6:139788727-139788749 CAGTGGGAGGGGGTGGTGGGGGG + Intergenic
1016197721 6:141366442-141366464 CAGGGGGATGGGATGGGGGAGGG - Intergenic
1016687636 6:146899643-146899665 GGGTGGGATGGGGTGGGGGAGGG - Intergenic
1016738558 6:147506858-147506880 CTGGGCGCTGGGATGCTGGAAGG - Intergenic
1017339316 6:153302200-153302222 CTGTGGGATGAGATGGAGTTTGG - Intergenic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018273155 6:162102182-162102204 CTGGGGGATGGGTGGGGGGACGG - Intronic
1018349762 6:162943958-162943980 CTGTGGGCTGGGCAGGTGGGTGG - Intronic
1018731722 6:166656595-166656617 CTCTGGGATGCGAAGATGGATGG + Intronic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG + Intronic
1019436017 7:1022556-1022578 CCGTGGGAGGAGGTGGTGGAGGG - Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019487786 7:1297197-1297219 GTGTGGGAGGGGGTGGTGGCAGG + Intergenic
1019520904 7:1460041-1460063 CGGTGGGGTGAGATGGTGGTGGG - Intergenic
1019549599 7:1595360-1595382 CGGATGGATGGGAGGGTGGATGG - Intergenic
1019704557 7:2491339-2491361 ATGGGGGATGGGTGGGTGGATGG - Intergenic
1019704588 7:2491446-2491468 TTGGGGGATGGGTGGGTGGATGG - Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1020035642 7:4961365-4961387 CTGGGGGGTGGGGTGGGGGATGG + Intergenic
1020231552 7:6322882-6322904 CTTTGGGATGCCAAGGTGGAAGG + Intergenic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1020583168 7:10031382-10031404 ATGAGGGATGGGAGGGTGCATGG + Intergenic
1021362245 7:19730011-19730033 CTTTGGGAGGTCATGGTGGACGG + Intronic
1022253891 7:28636273-28636295 CTGGGGGGTGGGAGGGAGGAGGG + Intronic
1022652557 7:32290407-32290429 CTGTTGGTTGTGATGATGGAGGG - Intronic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1023984397 7:45086479-45086501 CGGTGGGAGGGGCTGGTGGTGGG + Intronic
1024061145 7:45699602-45699624 CTGGGGGACGGGAGGGTGGGAGG + Intronic
1024071608 7:45790746-45790768 CTTTGGGAGGGGGTGGTGGGGGG - Intergenic
1024365784 7:48518958-48518980 TTGGGGGATGGGGTGGGGGAGGG - Intronic
1024507290 7:50172774-50172796 GGATGGGATGGGATGGTGGCCGG - Intergenic
1024570835 7:50721875-50721897 CTGTGGGAAGGGAAGGTGTCTGG + Intronic
1025019372 7:55468600-55468622 CTATGGGATGGGCTAGAGGATGG + Intronic
1025034512 7:55585258-55585280 GTGGGGGATGGGACAGTGGAGGG + Intergenic
1025114065 7:56242904-56242926 TTGAGGGATGGGTTGGTGGTAGG - Intergenic
1025114743 7:56248057-56248079 TTGAGGGATGGGTTGGTGGTAGG - Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026043952 7:66892343-66892365 CTTTGGGAGGGGGTGGTGGGAGG - Intergenic
1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG + Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027220956 7:76213629-76213651 CTGTAGGATGGGCTGAAGGATGG + Intronic
1027724678 7:81789104-81789126 CTGTGTGCTGACATGGTGGATGG - Intergenic
1028577654 7:92370171-92370193 CTGTGGGATGGGTGGCTGGCAGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1029974010 7:104815718-104815740 GTGTGGGGTGGGGTGGTGGTAGG - Intronic
1030003100 7:105086479-105086501 CTGTGGGAGGCCATGGTGGGCGG + Intronic
1030610609 7:111684940-111684962 CTTTGGGATGCGAAGGTGGGTGG + Intergenic
1031357061 7:120800240-120800262 ATGTGGGATGGGCTGTTTGAGGG - Intronic
1031493315 7:122416697-122416719 AGGTGGGGTGGGATGGTGGCTGG - Intronic
1031884574 7:127232491-127232513 CTGTGGGAGGCCAAGGTGGATGG - Intronic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1031940627 7:127785150-127785172 CTGTGGGAGGCCAAGGTGGAAGG - Intronic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032485044 7:132279383-132279405 CTTTGGGATGCCAAGGTGGAAGG + Intronic
1033124667 7:138697125-138697147 CTTTGGGATGCCACGGTGGAAGG + Intronic
1033261713 7:139849680-139849702 CTGGGGGATGGGATGGGGCGGGG + Intronic
1033879916 7:145868813-145868835 CAGTGGGATGGGTTGCTGCAAGG + Intergenic
1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG + Intronic
1034267877 7:149789918-149789940 CTCTGGGATGGGAAGGAGCAGGG + Intergenic
1034400521 7:150858664-150858686 CTGTTGGATGTGGTGGAGGATGG + Intronic
1034823675 7:154240485-154240507 CTGAGGCATGGGATGGAAGATGG - Intronic
1034936715 7:155204703-155204725 CTTTGGGATGGGATGGTGGAGGG - Intergenic
1035074455 7:156169015-156169037 GTGTGGGGTGGGATGCTGGGGGG + Intergenic
1035284683 7:157798819-157798841 CTGTGGGGTGGGGTGGGGCAGGG + Intronic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1035987703 8:4453168-4453190 CTGTGTGTTGGGATGGAGGGGGG - Intronic
1036047516 8:5160384-5160406 CTGTGGGAGGCCAAGGTGGATGG - Intergenic
1036191962 8:6678689-6678711 CTGTGGGAGGCCAAGGTGGATGG + Intergenic
1036461456 8:8956943-8956965 CTTTGGGATGCCAAGGTGGATGG + Intergenic
1036610731 8:10347620-10347642 CTTTGGGATGGCGTGGAGGATGG - Intronic
1036630549 8:10511227-10511249 ATGTGGGAAGGGACTGTGGAAGG - Intergenic
1037965835 8:23133463-23133485 CTGTGGGAGGCCAAGGTGGATGG + Intergenic
1038190378 8:25314607-25314629 CGGTTGGATGGGTAGGTGGATGG - Intronic
1038879173 8:31588581-31588603 CTGTGGGATGAGATGTTTTAGGG + Intergenic
1038999994 8:32969105-32969127 CTTTGGGATGCCATGGTGGGAGG + Intergenic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1039561389 8:38514880-38514902 CCTAGGGGTGGGATGGTGGATGG + Intronic
1039635475 8:39159887-39159909 GTGTGAGATGGGATGGTAGGTGG + Intronic
1040002480 8:42590170-42590192 CTTTGGGAGGGCATGGTGGGTGG + Intergenic
1040532971 8:48280867-48280889 GTGTGGAATGGGTGGGTGGATGG - Intergenic
1040561937 8:48530332-48530354 CTTTGGGGTGGCATGGGGGAGGG - Intergenic
1040953918 8:52961131-52961153 CTGTTGGATGGGGTGATGAAGGG - Intergenic
1041134829 8:54747005-54747027 CTGAGGGATTGGATTTTGGAGGG - Intergenic
1041450719 8:58004030-58004052 CTGGGGGATGGGGTGGGGGAGGG + Intronic
1041726556 8:61023455-61023477 CTGTGGGATGTAATGGTGCATGG - Intergenic
1041839035 8:62248430-62248452 CTGGGGGTTGGGAGGGTGGTCGG - Intergenic
1042449416 8:68927043-68927065 CTTTGGGATGCTAAGGTGGATGG + Intergenic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1045661109 8:104438837-104438859 CTGTGGGAGGCCATGGTGGGAGG + Intronic
1045780055 8:105852058-105852080 CTGTTGGATGAAATGTTGGATGG - Intergenic
1046011805 8:108557501-108557523 CTGGGGGATGGGAGGGTGGTTGG + Intergenic
1046687362 8:117242508-117242530 TTGTGGGATGGGTGGGTGGGAGG - Intergenic
1046836238 8:118804800-118804822 CTATGGGAGGCCATGGTGGAAGG - Intergenic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1047180718 8:122585171-122585193 CTGTGGGGTGGGGGGGTGGGGGG - Intergenic
1047195563 8:122718201-122718223 TTGTGGGATGGGATTGAGGTGGG - Intergenic
1047844761 8:128793984-128794006 CTGTGTCATGATATGGTGGAGGG - Intergenic
1047915073 8:129574323-129574345 CCGTGGGCTGGGTTGGTTGATGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048182214 8:132205961-132205983 CTTTGGTATGTGAAGGTGGAAGG + Intronic
1048294366 8:133203359-133203381 GTGTGTGATGGGCGGGTGGAGGG + Intronic
1049008502 8:139872549-139872571 CGGATGGATGGGCTGGTGGATGG + Intronic
1049247746 8:141571769-141571791 GTGTGGGAAAGGATAGTGGAAGG - Intergenic
1049420244 8:142513235-142513257 CTGTGAGATGGGAGGGCGGTTGG + Intronic
1049703882 8:144029046-144029068 CTGTCGGAGGGGTTGGGGGAGGG + Intronic
1049958666 9:716980-717002 CTGTGGGTGGGGGTGGTGGGGGG + Intronic
1050532792 9:6605399-6605421 CTGTGGGACGGGATGTGGGCAGG - Intronic
1051132952 9:13883132-13883154 CTATGGGATACCATGGTGGAAGG + Intergenic
1051286951 9:15507404-15507426 CTCTGGGAGGGCAAGGTGGATGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051528903 9:18078002-18078024 GGGTGGGAAGGGATGGAGGAAGG + Intergenic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1052817146 9:33110577-33110599 CTGTGGGATGGGGTGGGGACAGG - Intronic
1053396278 9:37777322-37777344 CTGTGGCCTGGGATGGGGAAGGG - Intronic
1053754145 9:41286091-41286113 CAGTGGCATGCGATTGTGGATGG - Intergenic
1054163231 9:61694432-61694454 CTTTGGGAGGGCAAGGTGGATGG + Intergenic
1055114606 9:72593293-72593315 CTTTGGGAGGCCATGGTGGAAGG + Intronic
1055388083 9:75786154-75786176 CTGTGGTCTGAGATGGTGGTTGG + Intergenic
1055859661 9:80732901-80732923 CTGTGGGGTGGGAGGCGGGAAGG - Intergenic
1055953336 9:81751152-81751174 CTGTGGGAGGCGGAGGTGGACGG - Intergenic
1056423992 9:86457837-86457859 GTGTGGAATTGGGTGGTGGACGG + Intergenic
1056455772 9:86757791-86757813 AACAGGGATGGGATGGTGGAAGG + Intergenic
1056634858 9:88323131-88323153 TGGTGGGATGGGATGATGGAGGG + Intergenic
1056840796 9:89996662-89996684 GAGTGGGATGGGAGGGTGGAGGG + Intergenic
1056902387 9:90611941-90611963 CTTGGGGATAGGATGGTGGCTGG - Exonic
1057142634 9:92736883-92736905 CTGTAGCGTGGGATGGTGCAGGG + Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057205068 9:93166926-93166948 CTGTGGGATGGGAAGGTACAGGG - Intergenic
1057616916 9:96599971-96599993 CTTTGGGATGCCAAGGTGGATGG - Intronic
1057778261 9:98028263-98028285 CTGTGGGATGCCAAGGTGGGCGG - Intergenic
1057881385 9:98795563-98795585 CTGTGGGAAGGCATGATGGGAGG - Intronic
1058021994 9:100099178-100099200 CTGTGGGATAGAAGGGCGGAGGG + Intergenic
1058842250 9:108921256-108921278 CTGTGGGGTGGGGTGGGGAAGGG - Intronic
1058855975 9:109062725-109062747 CTTTGGGAGGCCATGGTGGAAGG + Intronic
1058994614 9:110287571-110287593 CTGTGGGAGGCCAAGGTGGATGG - Intergenic
1059329715 9:113527176-113527198 CTATGGCAGGGAATGGTGGATGG - Intronic
1059456361 9:114402610-114402632 CAGTGGGCTGGGATGGAGGGGGG + Exonic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060571274 9:124642698-124642720 CTGTGGGGCAGGGTGGTGGAGGG + Intronic
1060572319 9:124653649-124653671 CTTTGGGACGCCATGGTGGAAGG - Intronic
1060882930 9:127131108-127131130 CTGTGGGCTGTGGGGGTGGAGGG + Intronic
1060946939 9:127575190-127575212 CTGTGAGGTGGGATGGAGCAGGG - Intronic
1061010783 9:127953529-127953551 CAGTGGGATGGAATGGGGGGTGG - Intronic
1061223242 9:129264736-129264758 ATGTGGGCTGGGATTGAGGAAGG + Intergenic
1061255802 9:129453763-129453785 ATGGGGGATGGGAAGATGGAGGG + Intergenic
1061328519 9:129878485-129878507 CTGGGAGATGGGATGCTGGCAGG + Intronic
1061630314 9:131868072-131868094 CTGTGGGGTGCCAGGGTGGAGGG + Intronic
1062363709 9:136199162-136199184 CTGTGGGGCGGGATGGGGGTGGG - Intronic
1062453966 9:136627139-136627161 GTGTGGGCTGGGATGGTGTGGGG - Intergenic
1062467508 9:136687647-136687669 CTGTGGGGAGGGAGCGTGGAGGG - Intergenic
1062751835 9:138260598-138260620 CTTTGGGAGGGGGTGGTGGGGGG - Intergenic
1203663322 Un_KI270754v1:3272-3294 ATTTGGGTGGGGATGGTGGAAGG + Intergenic
1185497488 X:566341-566363 ATGATGGATGGGATGATGGATGG + Intergenic
1185511479 X:667906-667928 GGGAGGGATGGGATGGGGGAGGG - Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG + Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186720733 X:12300903-12300925 CTGTAGGATGGCAAGGTGGAAGG - Intronic
1188016513 X:25112853-25112875 CTGTGGGAGGCCAAGGTGGAAGG - Intergenic
1188056287 X:25544481-25544503 CAGTAGGAAGGGATGGAGGAAGG - Intergenic
1189106636 X:38243336-38243358 CTGGGGGAGGGGATGGAGAAGGG + Intronic
1189232499 X:39463535-39463557 CTGTGGGAAGGGTGGATGGATGG + Intergenic
1189252335 X:39611038-39611060 GTGTGGGACGGGCAGGTGGAAGG + Intergenic
1189538908 X:41965947-41965969 CTTTGGTTTGGGATGGTGAAAGG + Intergenic
1189753074 X:44242753-44242775 CAGTAGGAGGAGATGGTGGATGG - Intronic
1190632706 X:52403538-52403560 CTGTGGTATGTGATTGTGAATGG - Intergenic
1191108104 X:56784656-56784678 GTGTTGGGTGGGATGGTGGTAGG + Intergenic
1191843315 X:65528427-65528449 CTATGGGAAGGGATCCTGGAGGG - Intronic
1192220602 X:69195145-69195167 ATGTGGGACTGGAAGGTGGAGGG + Intergenic
1192525325 X:71838073-71838095 TTGTGGGGTGGGAGGGGGGAGGG - Intergenic
1192755944 X:74047209-74047231 TTGGGGGATGGGGTGGTGAATGG + Intergenic
1192814482 X:74576664-74576686 CTTTGGGATGCCAAGGTGGAAGG + Intergenic
1193016235 X:76737381-76737403 TAGTGGGATGAGATGGTGGTGGG - Intergenic
1194792446 X:98167739-98167761 CAGTGGGAGAGGATGGTGAAAGG + Intergenic
1195112171 X:101659303-101659325 CTGGGGGATGGGAGGGTGCCGGG + Intronic
1197395922 X:125927511-125927533 TTGTGGGGTGGGACGGGGGAGGG - Intergenic
1199350174 X:146790817-146790839 TTGTGGGCTGGGTGGGTGGAAGG - Intergenic
1199786618 X:151112013-151112035 TTGTGGCATGGGATGGGGGCAGG + Intergenic
1200074930 X:153546170-153546192 CTGGGGGTGGGGCTGGTGGAGGG + Intronic
1200102367 X:153694458-153694480 CTGAGGGCTGGGCTGGGGGATGG + Intronic
1200594863 Y:5125975-5125997 CTGACGAATGAGATGGTGGAGGG + Intronic
1200808388 Y:7456737-7456759 CTTTGGGATGGCAAGGTGGGAGG - Intergenic
1201413999 Y:13729636-13729658 CTGGGGGATGGGCAGGGGGAAGG - Intergenic
1202375388 Y:24230656-24230678 CTGTGGGATGGGACTGTCCAAGG - Intergenic
1202495392 Y:25439463-25439485 CTGTGGGATGGGACTGTCCAAGG + Intergenic