ID: 1067227084

View in Genome Browser
Species Human (GRCh38)
Location 10:44383394-44383416
Sequence AGTTATGGGTGCAACTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067227084_1067227095 27 Left 1067227084 10:44383394-44383416 CCAGGTCAGTTGCACCCATAACT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1067227095 10:44383444-44383466 CTCTCTCCAGCCCTCCGGGGAGG No data
1067227084_1067227097 29 Left 1067227084 10:44383394-44383416 CCAGGTCAGTTGCACCCATAACT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1067227097 10:44383446-44383468 CTCTCCAGCCCTCCGGGGAGGGG No data
1067227084_1067227093 24 Left 1067227084 10:44383394-44383416 CCAGGTCAGTTGCACCCATAACT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1067227093 10:44383441-44383463 ATCCTCTCTCCAGCCCTCCGGGG No data
1067227084_1067227098 30 Left 1067227084 10:44383394-44383416 CCAGGTCAGTTGCACCCATAACT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1067227098 10:44383447-44383469 TCTCCAGCCCTCCGGGGAGGGGG No data
1067227084_1067227091 22 Left 1067227084 10:44383394-44383416 CCAGGTCAGTTGCACCCATAACT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1067227091 10:44383439-44383461 CAATCCTCTCTCCAGCCCTCCGG No data
1067227084_1067227096 28 Left 1067227084 10:44383394-44383416 CCAGGTCAGTTGCACCCATAACT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1067227096 10:44383445-44383467 TCTCTCCAGCCCTCCGGGGAGGG No data
1067227084_1067227092 23 Left 1067227084 10:44383394-44383416 CCAGGTCAGTTGCACCCATAACT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1067227092 10:44383440-44383462 AATCCTCTCTCCAGCCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067227084 Original CRISPR AGTTATGGGTGCAACTGACC TGG (reversed) Intronic
903003064 1:20280093-20280115 AGTTTTGGGTGCCAATGCCCAGG - Intergenic
905274371 1:36807510-36807532 TGTCATGGGTGCAATTGAACAGG + Intronic
913608987 1:120492547-120492569 AGGTATTGGTGCCATTGACCTGG + Intergenic
914204841 1:145517904-145517926 AGGTATTGGTGCCATTGACCTGG - Intergenic
914370724 1:147022324-147022346 AGGTATTGGTGCCATTGACCTGG + Intergenic
914483964 1:148091090-148091112 AGGTATTGGTGCCATTGACCTGG - Intergenic
914582204 1:149029291-149029313 AGGTATTGGTGCCATTGACCTGG - Intronic
918923732 1:190751367-190751389 AGAAATGTGTACAACTGACCCGG - Intergenic
1065529715 10:26656113-26656135 ATTGATGGATGCAACAGACCAGG - Intergenic
1065999467 10:31090923-31090945 AAGTTTGGGTGCAGCTGACCTGG + Intergenic
1067227084 10:44383394-44383416 AGTTATGGGTGCAACTGACCTGG - Intronic
1070393824 10:75994194-75994216 AATTTCAGGTGCAACTGACCAGG + Intronic
1073775466 10:106780728-106780750 ACTCATGGGTGGAACTGAACAGG - Intronic
1075427222 10:122351254-122351276 AGCTATGGGAGAAACTGACCTGG + Intergenic
1081159769 11:39737017-39737039 AGTTATGGGGGCAAAGGAACAGG - Intergenic
1085011557 11:73144787-73144809 AGTCTTGGGTGCAACTGGTCTGG + Intergenic
1085188806 11:74599841-74599863 CATTATGGGTGGAACTGATCAGG + Intronic
1090855332 11:130605744-130605766 AGTGATGAGTGCAAAAGACCAGG - Intergenic
1092960503 12:13592555-13592577 TGTCATGGGTGCAACTGGCTAGG - Intronic
1094499862 12:31011889-31011911 AGTAATGGGAGAAGCTGACCAGG - Intergenic
1097995243 12:65881571-65881593 AGTTATGACTGGAACTGTCCTGG + Intronic
1099017790 12:77365527-77365549 GGTAATGGATGCAACAGACCTGG + Intergenic
1103058280 12:117838485-117838507 AGTTTTGGGTGAAACTGATGTGG + Intronic
1108837495 13:54570146-54570168 TGTTATGGGTCCTTCTGACCTGG - Intergenic
1121284659 14:92725939-92725961 AGTTATGAGCTCATCTGACCGGG + Intronic
1121493906 14:94378855-94378877 AGTTGTGGGTGCACCTGAGCAGG - Intronic
1126108838 15:45163915-45163937 GGTTATGGGTTGGACTGACCTGG - Exonic
1127599452 15:60520701-60520723 AGTTTTGGGTGGAACTGAGGAGG + Intronic
1133672575 16:8038395-8038417 AGTTATGGGAGTAAATGACTGGG + Intergenic
1133985145 16:10662702-10662724 TGTCATGGGTGCAACTGGCTGGG - Intronic
1140956395 16:79870451-79870473 TGTTATGGGTGCATGTAACCTGG + Intergenic
1144842556 17:18197020-18197042 AGTTATGGGCCCAAAGGACCAGG - Intronic
1151423460 17:74014178-74014200 AGTTAGGGGTGCACCTGGCTGGG + Intergenic
1160081170 18:75728598-75728620 AGTGACGGGTGCATCTGACAAGG - Intergenic
1162634064 19:11952776-11952798 AGAGATGGGGGCACCTGACCAGG + Intronic
1164683059 19:30148764-30148786 AGCTATGGGTGCGTCTGTCCAGG - Intergenic
929665125 2:43827964-43827986 AGTTCTGGGTGCCACTTACTAGG + Exonic
941231360 2:162915853-162915875 TGTCATGGGTGCAACTGGCTGGG - Intergenic
944535939 2:200709928-200709950 ATTTATTGGTTGAACTGACCTGG - Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
944717820 2:202392695-202392717 AGTTAAGGGAGCATCTGGCCGGG + Intronic
946191101 2:218008417-218008439 AGTCTGGGGTCCAACTGACCTGG + Intergenic
946328503 2:218997068-218997090 AGCTCTGGGCGCAACTGATCTGG - Intergenic
946974255 2:225130482-225130504 AGATATGGTTACAACTGATCAGG + Intergenic
948274328 2:236696583-236696605 AGATATGGGAGCAACTGACATGG - Intergenic
1172964138 20:38821251-38821273 AGTTTTTGGTAGAACTGACCTGG + Intronic
1172971014 20:38873056-38873078 AGCTAAGGGTGCCACTGCCCTGG - Intronic
1181498288 22:23300717-23300739 GGTTATGTGGGCACCTGACCAGG - Intronic
954347960 3:50016737-50016759 AGTTAAGGCTGCAAATGAGCTGG - Intronic
955252683 3:57300244-57300266 TGTCTTGGGTGCAACTGACTGGG - Intronic
980931004 4:139182825-139182847 AGTTATAGGTGCAACTCATGAGG - Intergenic
981532120 4:145763045-145763067 GGTTGTGTGTGCACCTGACCTGG - Intronic
987832704 5:23117430-23117452 AGTTATGGAGAAAACTGACCAGG - Intergenic
992231736 5:74670713-74670735 GGTCATGGGTGCACCTGCCCGGG + Intronic
1000681404 5:164189477-164189499 AGTTATGGATACAACAGAGCTGG - Intergenic
1003991818 6:11493892-11493914 AGTCATGGGTGCTAATGAACTGG - Intergenic
1004022187 6:11786099-11786121 AACTAAGGGAGCAACTGACCAGG + Intronic
1007204597 6:40138499-40138521 AGTGATCGGTGCCACTGGCCAGG + Intergenic
1007245564 6:40459655-40459677 GGACATGGGAGCAACTGACCTGG - Intronic
1008164395 6:48118215-48118237 AGTAATAGCTGCAACTCACCTGG + Intergenic
1011649186 6:89490283-89490305 TTTTATGGGTGCAACTGACAGGG + Intronic
1014347964 6:120299692-120299714 AGTTTTTGGTAAAACTGACCTGG + Intergenic
1018637729 6:165879079-165879101 ATTTGGGGGTGCAACTGACCTGG + Intronic
1019146437 6:169978186-169978208 CGCTCTGGGTGCAGCTGACCCGG - Intergenic
1034374490 7:150630400-150630422 AGATAAAGGTGCAACTGGCCTGG + Intronic
1034998712 7:155594603-155594625 TGGTCTGGGTGCAGCTGACCTGG - Intergenic
1037184382 8:16044394-16044416 ATTTATGTGTGCAAGTGACGTGG + Intergenic
1042460642 8:69061542-69061564 AGTTCTTGTTGCCACTGACCAGG + Intergenic
1047861706 8:128974224-128974246 AGGTAGGGGTCAAACTGACCTGG + Intergenic
1057053715 9:91945930-91945952 AATTATAGCTGCAACTGGCCGGG - Intronic
1187711375 X:22057885-22057907 AGTTGTGGGGGCAGCTGACTGGG + Intronic
1188695120 X:33180588-33180610 AGTTTTGGGTTGAACTTACCTGG + Intronic
1190597635 X:52063927-52063949 AGGGATGGGTGCCTCTGACCTGG - Intronic
1190611189 X:52190146-52190168 AGGGATGGGTGCCTCTGACCTGG + Intronic
1192234424 X:69286638-69286660 AGTGAGGGGTGGAACTGAGCTGG + Intergenic
1198111218 X:133504153-133504175 AGGTAAGGCTGCAACAGACCAGG + Intergenic
1201638607 Y:16153821-16153843 GGTCATGGGTGCAACTGGCTGGG - Intergenic