ID: 1067231866

View in Genome Browser
Species Human (GRCh38)
Location 10:44417789-44417811
Sequence CTGTCTCCTTCCCATGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067231866_1067231873 17 Left 1067231866 10:44417789-44417811 CCTGGATCATGGGAAGGAGACAG No data
Right 1067231873 10:44417829-44417851 AGGAAAGTGCTCCAGAGACGGGG No data
1067231866_1067231867 -3 Left 1067231866 10:44417789-44417811 CCTGGATCATGGGAAGGAGACAG No data
Right 1067231867 10:44417809-44417831 CAGTCACAGAGCCACCTGCCAGG No data
1067231866_1067231871 15 Left 1067231866 10:44417789-44417811 CCTGGATCATGGGAAGGAGACAG No data
Right 1067231871 10:44417827-44417849 CCAGGAAAGTGCTCCAGAGACGG No data
1067231866_1067231872 16 Left 1067231866 10:44417789-44417811 CCTGGATCATGGGAAGGAGACAG No data
Right 1067231872 10:44417828-44417850 CAGGAAAGTGCTCCAGAGACGGG No data
1067231866_1067231874 18 Left 1067231866 10:44417789-44417811 CCTGGATCATGGGAAGGAGACAG No data
Right 1067231874 10:44417830-44417852 GGAAAGTGCTCCAGAGACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067231866 Original CRISPR CTGTCTCCTTCCCATGATCC AGG (reversed) Intergenic
No off target data available for this crispr