ID: 1067234277

View in Genome Browser
Species Human (GRCh38)
Location 10:44435276-44435298
Sequence CAGTGTCCCCAAAGCATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067234275_1067234277 -6 Left 1067234275 10:44435259-44435281 CCACTCGGGTCACTGTCCAGTGT No data
Right 1067234277 10:44435276-44435298 CAGTGTCCCCAAAGCATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067234277 Original CRISPR CAGTGTCCCCAAAGCATAGA TGG Intergenic
No off target data available for this crispr