ID: 1067235622

View in Genome Browser
Species Human (GRCh38)
Location 10:44446177-44446199
Sequence CAGGCTGCACGGCAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067235622_1067235638 25 Left 1067235622 10:44446177-44446199 CCCACCTCCTGCCGTGCAGCCTG No data
Right 1067235638 10:44446225-44446247 TGGTACTGGTCTGTGGCTGGGGG No data
1067235622_1067235632 11 Left 1067235622 10:44446177-44446199 CCCACCTCCTGCCGTGCAGCCTG No data
Right 1067235632 10:44446211-44446233 GCCATGGACTGAATTGGTACTGG No data
1067235622_1067235628 -5 Left 1067235622 10:44446177-44446199 CCCACCTCCTGCCGTGCAGCCTG No data
Right 1067235628 10:44446195-44446217 GCCTGATTCCTAACAGGCCATGG 0: 14
1: 248
2: 486
3: 724
4: 788
1067235622_1067235634 18 Left 1067235622 10:44446177-44446199 CCCACCTCCTGCCGTGCAGCCTG No data
Right 1067235634 10:44446218-44446240 ACTGAATTGGTACTGGTCTGTGG No data
1067235622_1067235636 23 Left 1067235622 10:44446177-44446199 CCCACCTCCTGCCGTGCAGCCTG No data
Right 1067235636 10:44446223-44446245 ATTGGTACTGGTCTGTGGCTGGG No data
1067235622_1067235635 22 Left 1067235622 10:44446177-44446199 CCCACCTCCTGCCGTGCAGCCTG No data
Right 1067235635 10:44446222-44446244 AATTGGTACTGGTCTGTGGCTGG No data
1067235622_1067235640 30 Left 1067235622 10:44446177-44446199 CCCACCTCCTGCCGTGCAGCCTG No data
Right 1067235640 10:44446230-44446252 CTGGTCTGTGGCTGGGGGTTGGG No data
1067235622_1067235639 29 Left 1067235622 10:44446177-44446199 CCCACCTCCTGCCGTGCAGCCTG No data
Right 1067235639 10:44446229-44446251 ACTGGTCTGTGGCTGGGGGTTGG No data
1067235622_1067235631 5 Left 1067235622 10:44446177-44446199 CCCACCTCCTGCCGTGCAGCCTG No data
Right 1067235631 10:44446205-44446227 TAACAGGCCATGGACTGAATTGG No data
1067235622_1067235637 24 Left 1067235622 10:44446177-44446199 CCCACCTCCTGCCGTGCAGCCTG No data
Right 1067235637 10:44446224-44446246 TTGGTACTGGTCTGTGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067235622 Original CRISPR CAGGCTGCACGGCAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr