ID: 1067236803

View in Genome Browser
Species Human (GRCh38)
Location 10:44458040-44458062
Sequence TGGGATTCCAGTACAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067236797_1067236803 30 Left 1067236797 10:44457987-44458009 CCATAGAGGAGCTGAAGGATACA No data
Right 1067236803 10:44458040-44458062 TGGGATTCCAGTACAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067236803 Original CRISPR TGGGATTCCAGTACAGAAAA AGG Intergenic
No off target data available for this crispr