ID: 1067238744

View in Genome Browser
Species Human (GRCh38)
Location 10:44472896-44472918
Sequence CTGCAGACAGACACAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067238744_1067238751 1 Left 1067238744 10:44472896-44472918 CCCTCTGCTGTGTCTGTCTGCAG No data
Right 1067238751 10:44472920-44472942 GGGTGCCAGCCCCCGGGAGGAGG No data
1067238744_1067238749 -5 Left 1067238744 10:44472896-44472918 CCCTCTGCTGTGTCTGTCTGCAG No data
Right 1067238749 10:44472914-44472936 TGCAGTGGGTGCCAGCCCCCGGG No data
1067238744_1067238748 -6 Left 1067238744 10:44472896-44472918 CCCTCTGCTGTGTCTGTCTGCAG No data
Right 1067238748 10:44472913-44472935 CTGCAGTGGGTGCCAGCCCCCGG No data
1067238744_1067238750 -2 Left 1067238744 10:44472896-44472918 CCCTCTGCTGTGTCTGTCTGCAG No data
Right 1067238750 10:44472917-44472939 AGTGGGTGCCAGCCCCCGGGAGG No data
1067238744_1067238752 2 Left 1067238744 10:44472896-44472918 CCCTCTGCTGTGTCTGTCTGCAG No data
Right 1067238752 10:44472921-44472943 GGTGCCAGCCCCCGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067238744 Original CRISPR CTGCAGACAGACACAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr