ID: 1067239232

View in Genome Browser
Species Human (GRCh38)
Location 10:44476318-44476340
Sequence AGGTGCAAGAAGGAGTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067239232_1067239238 5 Left 1067239232 10:44476318-44476340 CCTTCAAACTCCTTCTTGCACCT No data
Right 1067239238 10:44476346-44476368 CCATCACGCATTGACTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067239232 Original CRISPR AGGTGCAAGAAGGAGTTTGA AGG (reversed) Intergenic
No off target data available for this crispr