ID: 1067242091

View in Genome Browser
Species Human (GRCh38)
Location 10:44505863-44505885
Sequence CTGTGAGATGAGGAGACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067242088_1067242091 -1 Left 1067242088 10:44505841-44505863 CCTGCTGTGCTCATGGCCTGATC No data
Right 1067242091 10:44505863-44505885 CTGTGAGATGAGGAGACTGATGG No data
1067242082_1067242091 28 Left 1067242082 10:44505812-44505834 CCCTGTGGGGAGCCTGGGCCTTT No data
Right 1067242091 10:44505863-44505885 CTGTGAGATGAGGAGACTGATGG No data
1067242087_1067242091 0 Left 1067242087 10:44505840-44505862 CCCTGCTGTGCTCATGGCCTGAT No data
Right 1067242091 10:44505863-44505885 CTGTGAGATGAGGAGACTGATGG No data
1067242085_1067242091 10 Left 1067242085 10:44505830-44505852 CCTTTCACTTCCCTGCTGTGCTC No data
Right 1067242091 10:44505863-44505885 CTGTGAGATGAGGAGACTGATGG No data
1067242083_1067242091 27 Left 1067242083 10:44505813-44505835 CCTGTGGGGAGCCTGGGCCTTTC No data
Right 1067242091 10:44505863-44505885 CTGTGAGATGAGGAGACTGATGG No data
1067242080_1067242091 30 Left 1067242080 10:44505810-44505832 CCCCCTGTGGGGAGCCTGGGCCT No data
Right 1067242091 10:44505863-44505885 CTGTGAGATGAGGAGACTGATGG No data
1067242081_1067242091 29 Left 1067242081 10:44505811-44505833 CCCCTGTGGGGAGCCTGGGCCTT No data
Right 1067242091 10:44505863-44505885 CTGTGAGATGAGGAGACTGATGG No data
1067242084_1067242091 16 Left 1067242084 10:44505824-44505846 CCTGGGCCTTTCACTTCCCTGCT No data
Right 1067242091 10:44505863-44505885 CTGTGAGATGAGGAGACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067242091 Original CRISPR CTGTGAGATGAGGAGACTGA TGG Intergenic
No off target data available for this crispr