ID: 1067243599

View in Genome Browser
Species Human (GRCh38)
Location 10:44517418-44517440
Sequence CTTGGTCACTCCACTGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067243599_1067243603 -4 Left 1067243599 10:44517418-44517440 CCCAAGGCAGTGGAGTGACCAAG No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243599_1067243606 28 Left 1067243599 10:44517418-44517440 CCCAAGGCAGTGGAGTGACCAAG No data
Right 1067243606 10:44517469-44517491 GTGAGAACACAGCTGGCCTCCGG No data
1067243599_1067243605 21 Left 1067243599 10:44517418-44517440 CCCAAGGCAGTGGAGTGACCAAG No data
Right 1067243605 10:44517462-44517484 CGACTGAGTGAGAACACAGCTGG No data
1067243599_1067243601 -10 Left 1067243599 10:44517418-44517440 CCCAAGGCAGTGGAGTGACCAAG No data
Right 1067243601 10:44517431-44517453 AGTGACCAAGTGAGTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067243599 Original CRISPR CTTGGTCACTCCACTGCCTT GGG (reversed) Intergenic