ID: 1067243600

View in Genome Browser
Species Human (GRCh38)
Location 10:44517419-44517441
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067243600_1067243603 -5 Left 1067243600 10:44517419-44517441 CCAAGGCAGTGGAGTGACCAAGT No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243600_1067243605 20 Left 1067243600 10:44517419-44517441 CCAAGGCAGTGGAGTGACCAAGT No data
Right 1067243605 10:44517462-44517484 CGACTGAGTGAGAACACAGCTGG No data
1067243600_1067243606 27 Left 1067243600 10:44517419-44517441 CCAAGGCAGTGGAGTGACCAAGT No data
Right 1067243606 10:44517469-44517491 GTGAGAACACAGCTGGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067243600 Original CRISPR ACTTGGTCACTCCACTGCCT TGG (reversed) Intergenic