ID: 1067243603

View in Genome Browser
Species Human (GRCh38)
Location 10:44517437-44517459
Sequence CAAGTGAGTCCTTCAGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067243599_1067243603 -4 Left 1067243599 10:44517418-44517440 CCCAAGGCAGTGGAGTGACCAAG No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243590_1067243603 18 Left 1067243590 10:44517396-44517418 CCCATCCCCTTCATACTCCCTTC No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243597_1067243603 1 Left 1067243597 10:44517413-44517435 CCCTTCCCAAGGCAGTGGAGTGA No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243589_1067243603 19 Left 1067243589 10:44517395-44517417 CCCCATCCCCTTCATACTCCCTT No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243598_1067243603 0 Left 1067243598 10:44517414-44517436 CCTTCCCAAGGCAGTGGAGTGAC No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243592_1067243603 13 Left 1067243592 10:44517401-44517423 CCCCTTCATACTCCCTTCCCAAG No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243591_1067243603 17 Left 1067243591 10:44517397-44517419 CCATCCCCTTCATACTCCCTTCC No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243593_1067243603 12 Left 1067243593 10:44517402-44517424 CCCTTCATACTCCCTTCCCAAGG No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243587_1067243603 26 Left 1067243587 10:44517388-44517410 CCCATGTCCCCATCCCCTTCATA No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243600_1067243603 -5 Left 1067243600 10:44517419-44517441 CCAAGGCAGTGGAGTGACCAAGT No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243595_1067243603 11 Left 1067243595 10:44517403-44517425 CCTTCATACTCCCTTCCCAAGGC No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243588_1067243603 25 Left 1067243588 10:44517389-44517411 CCATGTCCCCATCCCCTTCATAC No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data
1067243586_1067243603 27 Left 1067243586 10:44517387-44517409 CCCCATGTCCCCATCCCCTTCAT No data
Right 1067243603 10:44517437-44517459 CAAGTGAGTCCTTCAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067243603 Original CRISPR CAAGTGAGTCCTTCAGGCAG TGG Intergenic