ID: 1067243604

View in Genome Browser
Species Human (GRCh38)
Location 10:44517446-44517468
Sequence TCAGTCGTTCCACTGCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067243604_1067243610 30 Left 1067243604 10:44517446-44517468 CCTTCAGGCAGTGGAACGACTGA No data
Right 1067243610 10:44517499-44517521 TCCTTCAAAGTCCACAGCCCAGG No data
1067243604_1067243606 0 Left 1067243604 10:44517446-44517468 CCTTCAGGCAGTGGAACGACTGA No data
Right 1067243606 10:44517469-44517491 GTGAGAACACAGCTGGCCTCCGG No data
1067243604_1067243605 -7 Left 1067243604 10:44517446-44517468 CCTTCAGGCAGTGGAACGACTGA No data
Right 1067243605 10:44517462-44517484 CGACTGAGTGAGAACACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067243604 Original CRISPR TCAGTCGTTCCACTGCCTGA AGG (reversed) Intergenic
No off target data available for this crispr