ID: 1067243605

View in Genome Browser
Species Human (GRCh38)
Location 10:44517462-44517484
Sequence CGACTGAGTGAGAACACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067243599_1067243605 21 Left 1067243599 10:44517418-44517440 CCCAAGGCAGTGGAGTGACCAAG No data
Right 1067243605 10:44517462-44517484 CGACTGAGTGAGAACACAGCTGG No data
1067243604_1067243605 -7 Left 1067243604 10:44517446-44517468 CCTTCAGGCAGTGGAACGACTGA No data
Right 1067243605 10:44517462-44517484 CGACTGAGTGAGAACACAGCTGG No data
1067243597_1067243605 26 Left 1067243597 10:44517413-44517435 CCCTTCCCAAGGCAGTGGAGTGA No data
Right 1067243605 10:44517462-44517484 CGACTGAGTGAGAACACAGCTGG No data
1067243600_1067243605 20 Left 1067243600 10:44517419-44517441 CCAAGGCAGTGGAGTGACCAAGT No data
Right 1067243605 10:44517462-44517484 CGACTGAGTGAGAACACAGCTGG No data
1067243598_1067243605 25 Left 1067243598 10:44517414-44517436 CCTTCCCAAGGCAGTGGAGTGAC No data
Right 1067243605 10:44517462-44517484 CGACTGAGTGAGAACACAGCTGG No data
1067243602_1067243605 3 Left 1067243602 10:44517436-44517458 CCAAGTGAGTCCTTCAGGCAGTG No data
Right 1067243605 10:44517462-44517484 CGACTGAGTGAGAACACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067243605 Original CRISPR CGACTGAGTGAGAACACAGC TGG Intergenic