ID: 1067243606

View in Genome Browser
Species Human (GRCh38)
Location 10:44517469-44517491
Sequence GTGAGAACACAGCTGGCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067243602_1067243606 10 Left 1067243602 10:44517436-44517458 CCAAGTGAGTCCTTCAGGCAGTG No data
Right 1067243606 10:44517469-44517491 GTGAGAACACAGCTGGCCTCCGG No data
1067243599_1067243606 28 Left 1067243599 10:44517418-44517440 CCCAAGGCAGTGGAGTGACCAAG No data
Right 1067243606 10:44517469-44517491 GTGAGAACACAGCTGGCCTCCGG No data
1067243600_1067243606 27 Left 1067243600 10:44517419-44517441 CCAAGGCAGTGGAGTGACCAAGT No data
Right 1067243606 10:44517469-44517491 GTGAGAACACAGCTGGCCTCCGG No data
1067243604_1067243606 0 Left 1067243604 10:44517446-44517468 CCTTCAGGCAGTGGAACGACTGA No data
Right 1067243606 10:44517469-44517491 GTGAGAACACAGCTGGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067243606 Original CRISPR GTGAGAACACAGCTGGCCTC CGG Intergenic