ID: 1067243607

View in Genome Browser
Species Human (GRCh38)
Location 10:44517485-44517507
Sequence TTTGAAGGAGTGGCTGCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067243607_1067243614 6 Left 1067243607 10:44517485-44517507 CCTCCGGCAGCCACTCCTTCAAA No data
Right 1067243614 10:44517514-44517536 AGCCCAGGCAACATGGTTCCTGG No data
1067243607_1067243619 23 Left 1067243607 10:44517485-44517507 CCTCCGGCAGCCACTCCTTCAAA No data
Right 1067243619 10:44517531-44517553 TCCTGGGGTGACCAGCTCTGAGG No data
1067243607_1067243610 -9 Left 1067243607 10:44517485-44517507 CCTCCGGCAGCCACTCCTTCAAA No data
Right 1067243610 10:44517499-44517521 TCCTTCAAAGTCCACAGCCCAGG No data
1067243607_1067243615 7 Left 1067243607 10:44517485-44517507 CCTCCGGCAGCCACTCCTTCAAA No data
Right 1067243615 10:44517515-44517537 GCCCAGGCAACATGGTTCCTGGG No data
1067243607_1067243612 -1 Left 1067243607 10:44517485-44517507 CCTCCGGCAGCCACTCCTTCAAA No data
Right 1067243612 10:44517507-44517529 AGTCCACAGCCCAGGCAACATGG No data
1067243607_1067243617 8 Left 1067243607 10:44517485-44517507 CCTCCGGCAGCCACTCCTTCAAA No data
Right 1067243617 10:44517516-44517538 CCCAGGCAACATGGTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067243607 Original CRISPR TTTGAAGGAGTGGCTGCCGG AGG (reversed) Intergenic