ID: 1067243608

View in Genome Browser
Species Human (GRCh38)
Location 10:44517488-44517510
Sequence GACTTTGAAGGAGTGGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067243608_1067243615 4 Left 1067243608 10:44517488-44517510 CCGGCAGCCACTCCTTCAAAGTC No data
Right 1067243615 10:44517515-44517537 GCCCAGGCAACATGGTTCCTGGG No data
1067243608_1067243619 20 Left 1067243608 10:44517488-44517510 CCGGCAGCCACTCCTTCAAAGTC No data
Right 1067243619 10:44517531-44517553 TCCTGGGGTGACCAGCTCTGAGG No data
1067243608_1067243617 5 Left 1067243608 10:44517488-44517510 CCGGCAGCCACTCCTTCAAAGTC No data
Right 1067243617 10:44517516-44517538 CCCAGGCAACATGGTTCCTGGGG No data
1067243608_1067243614 3 Left 1067243608 10:44517488-44517510 CCGGCAGCCACTCCTTCAAAGTC No data
Right 1067243614 10:44517514-44517536 AGCCCAGGCAACATGGTTCCTGG No data
1067243608_1067243612 -4 Left 1067243608 10:44517488-44517510 CCGGCAGCCACTCCTTCAAAGTC No data
Right 1067243612 10:44517507-44517529 AGTCCACAGCCCAGGCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067243608 Original CRISPR GACTTTGAAGGAGTGGCTGC CGG (reversed) Intergenic
No off target data available for this crispr