ID: 1067243609

View in Genome Browser
Species Human (GRCh38)
Location 10:44517495-44517517
Sequence GGCTGTGGACTTTGAAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067243609_1067243619 13 Left 1067243609 10:44517495-44517517 CCACTCCTTCAAAGTCCACAGCC No data
Right 1067243619 10:44517531-44517553 TCCTGGGGTGACCAGCTCTGAGG No data
1067243609_1067243617 -2 Left 1067243609 10:44517495-44517517 CCACTCCTTCAAAGTCCACAGCC No data
Right 1067243617 10:44517516-44517538 CCCAGGCAACATGGTTCCTGGGG No data
1067243609_1067243624 30 Left 1067243609 10:44517495-44517517 CCACTCCTTCAAAGTCCACAGCC No data
Right 1067243624 10:44517548-44517570 CTGAGGAAGCCAGAGAGGGCAGG No data
1067243609_1067243623 26 Left 1067243609 10:44517495-44517517 CCACTCCTTCAAAGTCCACAGCC No data
Right 1067243623 10:44517544-44517566 AGCTCTGAGGAAGCCAGAGAGGG No data
1067243609_1067243622 25 Left 1067243609 10:44517495-44517517 CCACTCCTTCAAAGTCCACAGCC No data
Right 1067243622 10:44517543-44517565 CAGCTCTGAGGAAGCCAGAGAGG No data
1067243609_1067243615 -3 Left 1067243609 10:44517495-44517517 CCACTCCTTCAAAGTCCACAGCC No data
Right 1067243615 10:44517515-44517537 GCCCAGGCAACATGGTTCCTGGG No data
1067243609_1067243614 -4 Left 1067243609 10:44517495-44517517 CCACTCCTTCAAAGTCCACAGCC No data
Right 1067243614 10:44517514-44517536 AGCCCAGGCAACATGGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067243609 Original CRISPR GGCTGTGGACTTTGAAGGAG TGG (reversed) Intergenic
No off target data available for this crispr