ID: 1067243610

View in Genome Browser
Species Human (GRCh38)
Location 10:44517499-44517521
Sequence TCCTTCAAAGTCCACAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067243607_1067243610 -9 Left 1067243607 10:44517485-44517507 CCTCCGGCAGCCACTCCTTCAAA No data
Right 1067243610 10:44517499-44517521 TCCTTCAAAGTCCACAGCCCAGG No data
1067243604_1067243610 30 Left 1067243604 10:44517446-44517468 CCTTCAGGCAGTGGAACGACTGA No data
Right 1067243610 10:44517499-44517521 TCCTTCAAAGTCCACAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067243610 Original CRISPR TCCTTCAAAGTCCACAGCCC AGG Intergenic
No off target data available for this crispr