ID: 1067243612

View in Genome Browser
Species Human (GRCh38)
Location 10:44517507-44517529
Sequence AGTCCACAGCCCAGGCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067243608_1067243612 -4 Left 1067243608 10:44517488-44517510 CCGGCAGCCACTCCTTCAAAGTC No data
Right 1067243612 10:44517507-44517529 AGTCCACAGCCCAGGCAACATGG No data
1067243607_1067243612 -1 Left 1067243607 10:44517485-44517507 CCTCCGGCAGCCACTCCTTCAAA No data
Right 1067243612 10:44517507-44517529 AGTCCACAGCCCAGGCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067243612 Original CRISPR AGTCCACAGCCCAGGCAACA TGG Intergenic
No off target data available for this crispr