ID: 1067243617

View in Genome Browser
Species Human (GRCh38)
Location 10:44517516-44517538
Sequence CCCAGGCAACATGGTTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067243608_1067243617 5 Left 1067243608 10:44517488-44517510 CCGGCAGCCACTCCTTCAAAGTC No data
Right 1067243617 10:44517516-44517538 CCCAGGCAACATGGTTCCTGGGG No data
1067243609_1067243617 -2 Left 1067243609 10:44517495-44517517 CCACTCCTTCAAAGTCCACAGCC No data
Right 1067243617 10:44517516-44517538 CCCAGGCAACATGGTTCCTGGGG No data
1067243607_1067243617 8 Left 1067243607 10:44517485-44517507 CCTCCGGCAGCCACTCCTTCAAA No data
Right 1067243617 10:44517516-44517538 CCCAGGCAACATGGTTCCTGGGG No data
1067243611_1067243617 -7 Left 1067243611 10:44517500-44517522 CCTTCAAAGTCCACAGCCCAGGC No data
Right 1067243617 10:44517516-44517538 CCCAGGCAACATGGTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067243617 Original CRISPR CCCAGGCAACATGGTTCCTG GGG Intergenic
No off target data available for this crispr