ID: 1067246438

View in Genome Browser
Species Human (GRCh38)
Location 10:44550536-44550558
Sequence CTTGCTAGGCTGCTCCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067246436_1067246438 6 Left 1067246436 10:44550507-44550529 CCACAGTTTTCTCTGGGGTGTTC No data
Right 1067246438 10:44550536-44550558 CTTGCTAGGCTGCTCCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067246438 Original CRISPR CTTGCTAGGCTGCTCCTTCA TGG Intergenic
No off target data available for this crispr