ID: 1067246786

View in Genome Browser
Species Human (GRCh38)
Location 10:44554091-44554113
Sequence GACTCAGTGCTGGGGTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067246786_1067246790 -3 Left 1067246786 10:44554091-44554113 CCACAATACCCCAGCACTGAGTC No data
Right 1067246790 10:44554111-44554133 GTCCGCTCCATGCACACCTGAGG No data
1067246786_1067246791 -2 Left 1067246786 10:44554091-44554113 CCACAATACCCCAGCACTGAGTC No data
Right 1067246791 10:44554112-44554134 TCCGCTCCATGCACACCTGAGGG No data
1067246786_1067246796 12 Left 1067246786 10:44554091-44554113 CCACAATACCCCAGCACTGAGTC No data
Right 1067246796 10:44554126-44554148 ACCTGAGGGGAAGCCTCAAAGGG No data
1067246786_1067246795 11 Left 1067246786 10:44554091-44554113 CCACAATACCCCAGCACTGAGTC No data
Right 1067246795 10:44554125-44554147 CACCTGAGGGGAAGCCTCAAAGG No data
1067246786_1067246793 -1 Left 1067246786 10:44554091-44554113 CCACAATACCCCAGCACTGAGTC No data
Right 1067246793 10:44554113-44554135 CCGCTCCATGCACACCTGAGGGG No data
1067246786_1067246799 28 Left 1067246786 10:44554091-44554113 CCACAATACCCCAGCACTGAGTC No data
Right 1067246799 10:44554142-44554164 CAAAGGGCCGAACGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067246786 Original CRISPR GACTCAGTGCTGGGGTATTG TGG (reversed) Intergenic